Cancer Research Targets  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 8085, October 1, 2008. doi: 10.1158/0008-5472.CAN-08-1014
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pellicciotta, I.
Right arrow Articles by Zanetti, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pellicciotta, I.
Right arrow Articles by Zanetti, M.

Immunology

Presentation of Telomerase Reverse Transcriptase, a Self-Tumor Antigen, is Down-regulated by Histone Deacetylase Inhibition

Ilenia Pellicciotta1, Xochitl Cortez-Gonzalez1, Roman Sasik2, Yoram Reiter3, Gary Hardiman2, Pierre Langlade-Demoyen4 and Maurizio Zanetti1

1 The Laboratory of Immunology, Department of Medicine and Moores Cancer Center and 2 Department of Medicine and BIOGEM, University of California, San Diego, La Jolla, California; 3 Department of Biology, Technion-Israel Institute of Technology, Haifa, Israel; and 4 Unite' de Retrovirologie Moleculaire, Institut Pasteur, Paris, France

Requests for reprints: Maurizio Zanetti, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0815. Phone: 858-822-5412; Fax: 858-822-5421; E-mail: mzanetti{at}ucsd.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Histone deacetylases (HDAC) modify the architecture of chromatin, leading to decreased gene expression, an effect that is reversed by HDAC inhibition. The balance between deacetylation and acetylation is central to many biological events including the regulation of cell proliferation and cancer but also the differentiation of immune T cells. The effects of HDAC inhibition on the interaction between antitumor effector T cells and tumor cells are not known. Here, we studied presentation of a universal self-tumor antigen, telomerase reverse transcriptase, in human tumor cells during HDAC inhibition. We found that HDAC inhibition with trichostatin A was associated with a decreased presentation and diminished killing of tumor cells by CTLs. Using gene array analysis, we found that HDAC inhibition resulted in a decrease of genes coding for proteasome catalytic proteins and for tapasin, an endoplasmic reticulum resident protein involved in the MHC class I pathway of endogenous antigen presentation. Our findings indicate that epigenetic changes in tumor cells decrease self-tumor antigen presentation and contribute to reduced recognition and killing of tumor cells by cytotoxic T lymphocytes. This mechanism could contribute to tumor escape from immune surveillance. [Cancer Res 2008;68(19):8085–93]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Epigenetic modifications influence gene activity without altering DNA sequences from the transcriptional activity of selected genes to the individual's susceptibility to disease (1), and include both transient modifications and stable heritable changes (2). Acetylation and deacetylation of histones impart modification on the architecture of chromatin (3), which reflect on increased or decreased gene expression through the opposing activities of histone acetyltransferases and histone deacetylases (HDAC). Acetylation plays a critical role in the regulation of cell proliferation (4) and transcriptional silencing associated with a generalized loss of acetylation has been found in cancer (5). Levels of acetylation also play a role in the differentiation of T cells (6, 7) and in the expression of ligands for natural killer (NK) cells (8). Although mouse tumor cells treated with high dose HDAC inhibitors are immunogenic and confer partial protection from tumor growth in vivo (9), little is known on whether epigenetic changes of chromatin structure influence antigen presentation in human tumor cells.

Here, we studied the effect of HDAC inhibiton on the presentation of telomerase reverse transcriptase (TRT), a bona fide universal antigen in human cancer cells (10, 11) using trichostatin A (TSA), a natural product hydroximate with high affinity for the catalytic site of class I and II HDAC (12). We monitored the surface density of complexes formed between the major histocompatibility/Human Leukocyte Antigen (HLA)-A2 molecule and two high-affinity 9mer hTRT peptides: 540ILAKFLHWL548 (p540) and 865RLVDDFLLV873 (p865; ref. 11). Because telomerase is expressed in >85% of human cancers (13) and CD8 T cells specific for p540 are found in the blood of cancer patients at high frequency (14), the model system studied herein is relevant to better understanding the relation between cancer cells and the antitumor immune response in humans. Our findings show a reduction of HLA-A2/hTRT peptide complexes at the cell surface of TSA-treated human tumor cells. More importantly, using a highly specific human cytotoxic T-lymphocyte (CTL) clone, we found that TSA-treated cancer cell killing was reduced compared with untreated cells. This finding may be relevant to understand how immunosurvelliance of cancer cells can be affected in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Cell Lines and Inhibitors
The human B-lymphoblastoid JY cell line and prostate cancer cells LnCap (the kind gift of Dr. A. Vitiello, The R.W. Johnson Pharmaceutical Research Institute, San Diego, CA), melanoma cells 629.38 (the kind gift of Dr. S. Rosenberg, Surgery Branch, National Cancer Institute, Bethesda, MD), and TAP-deficient T2 cells (the kind gift of Dr. P. Creswell, Yale University, New Haven, CT) were cultured in complete RPMI 1640 supplemented with 10% fetal bovine serum (FBS). TSA, Lactacystin, Sodium butyrate, and BFA were purchased from Sigma.

Immunochemical Detection of hTRT, HLA-A2/hTRT Complexes, and HLA-A2
Detection of HLA-A2/hTRT complexes at the cell surface. HLA-A2/p540 and HLA-A2/p865 complexes were detected with the human Fab 4A9 and 3H2 (15), respectively. Briefly, cells were treated with TSA (1 µg/mL), BFA (10 µg/mL), or lactacystin (10 µmol/mL). After washing, cells were incubated with human Fab 4A9 or 3H2 (2 µg per reaction) for 1.5 h at +4°C. After washing, cells were counterstained with FITC-conjugated goat antibody to human Fab (Jackson Laboratories) for 45 min. Surface staining for HLA-A2 was performed using monoclonal antibody BB7.2 (ATTC) followed by a FITC-conjugated goat antibody to mouse IgG (eBioscience). Cells were analyzed in a FACSCalibur (Becton Dickinson) using the BD CellQuest data acquisition and analysis software.

Cytotoxicity Assays
Buffy coats from HLA-A2.1 healthy donors were purchased from the Blood bank of Hopital Henry Mondor in accordance with an approved Institutional Review Board protocol. HTERT-specific human CTL lines were generated according to published procedure (11). Briefly, peripheral blood mononuclear cells were stimulated with hTERT peptides in vitro in 24-well plates using autologous irradiated adherents cells as antigen-presenting cells and interleukin (IL)-2 and IL-7. After three to four rounds of culture, CTLs were screened in a standard 51Cr-release assay. The cold target inhibition assay (11) was performed to ensure the specificity of the CTL clone. T2 cells were pulsed with either p540 or the HIV p17 gag 77-85 peptide as a control. An adaptation of this assay was used to investigate killing inhibition where 51Cr-labeled targets treated with TSA were used (Fig. 6C and D). In these experiments, the E:T ratio was kept constant at 20:1, whereas the cold/hot inhibitor ratio varied as indicated in the legend to the figure.


Figure 6
View larger version (17K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Reduced killing of human tumor cells treated by TSA by CTL specific for the HLA A2/p540 complex. CTL from an individual donor immunized in vitro against p540 (11) were used as effectors (E) against 51Cr-labeled tumor targets (T) treated (18 h) with TSA (1 µg/mL). A, direct lysis of TSA-treated or untreated human tumor cells (JY, LnCap, and Mel 629). T2 cells pulsed with p540 served as a control for the ability of the CTL clone to lyse p540 pulsed targets. Results refer to percent (%) lysis at the E:T ratios indicated. B, specificity of CTL by cold target inhibition assay. 51Cr-labeled, TSA-treated JY cells (5 x 104 cells/mL) were mixed with T2 cells pulsed with p540 (10 µg/mL; {blacktriangleup}) or T2 cells pulsed with control HIV-1 gag peptide at the indicated cold/hot target cell ratios. The E:T ratio was kept constant at 20:1. Results refer to percent lysis according to ref. 11. Tests were run in triplicate. C to D, TSA treatment of tumor cells decreases presentation of p540 and, as a result, enhances cold target inhibition. The canonical CTL reaction was set at a fixed E:T ratio of 20:1. Hot target cells were mixed at cold/hot ratio of 50:1 (C) or 250:1 (D); black columns, cold T2 cells pulsed with p540; open columns, cold T2 cells pulsed with control HIV-1 gag peptide. Results are expressed as killing of tumor cells, with or without TSA treatment, in the presence of T2 cells pulsed with p540 as a proportion of killing in presence of T2 cells pulsed with control gag peptide that was used as 100% killing.

 
Proteasome Activity Assay
JY cells were treated with TSA (1 µg/mL), Sodium Butyrate (20 µg/mL), Lactacystin (3.8 µg/mL), or 5 µL of DMSO (untreated) in RPMI supplemented with 5% FBS for 18 h. Sodium Butyrate was used as a control based on the fact that to the best of our knowledge it is the only HDAC inhibitor reported to reduce proteasome activity beside TSA (16). Lactacystin served as a generic inhibitor of proteasome function. Cells were harvested, washed, and resuspended in complete medium. Proteasome activity assay was performed using the cell-based luminescent assay Proteasome-Glo (Promega) in white flat-bottomed 96-well plates (Costar) with 20,000 cells per well. Luminescence was measured in a plate reader Infinite M200 (TECAN). Assays were done in triplicate and repeated twice with similar results.

Deconvolution and Fluorescence Microscopy
Cells treated with TSA and immunostained as described above were also used for deconvolution microscopy studies. Briefly, after staining with antibodies, cells were incubated with 4',6-diamidino-2-phenylindole-HCl for 15 min, and then cytospun onto glass slides. Slides were air dried and mounted in glycerol using coverslips (Fisher Scientific). The slides were examined by epifluorescence microscopy (Nikon T200 microscope) mounted on Delta Vision deconvolution microscope (Applied Precision, LLC). In some cases, where indicated, deconvolution was performed on the resultant image stacks using SoftWorx as supplied by the manufacturer (Applied Precision, LLC). Images shown in Figs. 2 and 3 were volume projections of several consecutive optical sections taken from the center of the image stacks after deconvolution. In experiments where comparative quantitation of fluorescence was performed, samples to be compared were stained under identical conditions with the same reagents at the same time. Samples were imaged under identical conditions. Camera exposure time was identical and pixel intensities were kept within the linear range of the camera (CoolSnap HQ; Princeton Instruments). Quantitation was performed on volume projections composed of several consecutive optical sections. The resultant volume projections were scaled identically. Quantitation was performed using SoftWorx at Data Inspector.


Figure 2
View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Deconvolution microscopy analysis of decreased presentation of HLA-A2/hTRT peptide complexes by TSA treatment. A, deconvolution microscopy analysis of surface (Sfc) staining for the HLA-A2/p540 complex in untreated and TSA-treated (18 h) JY cells. Green, HLA-A2/p540 complexes; blue, nuclei (magnification, x60). Analyses were performed as detailed in Materials and Methods. Data are representative of four independent experiments. B, quantitation of fluorescence intensity of the optical images shown in A. The scale represents a gradient of pixel intensities. Analyses were performed as detailed in Materials and Methods. C, deconvolution microscopy visualization of surface HLA-A2/p540 complexes at higher magnification (x100) comparing surface contour of untreated and TSA-treated (18 h) JY cells. Green, complexes; blue, nuclei.

 

Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. TSA treatment down-regulates presentation in 629.38 melanoma cells. Melanoma cells (629.38) were treated with TSA (1 µg/mL) for 18 h. A, RNA was extracted and tested by RT-PCR for hTRT transcription as indicated in Materials and Methods. B, cells were cell surface stained with antibody 4A9 to visualize the HLA-A2/p540 complexes as indicated in Materials and Methods. Green, HLA-A2/p540 complexes; blue, nuclei (magnification, x60). C, HLA-A2 expression was assessed by flow cytometry.

 
Reverse Transcriptase-PCR
hTRT mRNA was detected by reverse transcriptase (RT)-PCR analysis. Briefly, 106 cells were treated with TSA (1 µg/mL) for the indicated time, and total RNA was isolated using the RNAeasy Mini kit (Qiagen). The RNA was reverse transcribed into cDNA by RT-Omniscript (Qiagen) for 1 h at 37°C. cDNA amplification was induced using specific primers (forward 5'-ACCAAGAAGTTCATCTCCCTGG-3' and reverse 5'-GCTCATCTTCCACGTCAGCTC-3'). Amplification of the glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA served as a control for RNA extraction.

Quantitative RT-PCR
cDNA was generated from 200 ng of total RNA using Omniscript Reverse Transcriptase (Qiagen). Quantitative RT-PCR (qRT-PCR) was carried out using the Taqman method on a LightCycler 480 real-time PCR system (Roche) and analyzed by efficiency-corrected relative quantification method. Sequences for probes and primers were as follows: tapasin (NM_003190.3): Forward, CCAGAGCCTCAGCAGGAG; Reverse, GGGTGAGGACAGTCAGTACCA; Universal ProbeLibrary probe #9 (Roche Applied Science): GADPH, Forward AGCCACATCGCTGAGACA; Reverse, GCCCAATACGACCAAATCC; Universal ProbeLibrary probe #60 (Roche Applied Science). Results were expressed as fold change compared with untreated cells.

DNA Microarray
Biotinylated cRNA was prepared using the Illumina RNA Amplification kit (Ambion, Inc.) according to the manufacturer's directions starting with 250 ng total RNA. The labeling approach uses a modified Eberwine protocol (17) by which mRNA is converted to cDNA, followed by an amplification/labeling step mediated by T7 DNA polymerase. The cDNA and cRNA filter cartridges (Ambion) were used according to the manufacturer's instructions for RT and IVT cleanup, respectively. For microarray analysis, the Illumina Human Expression BeadChip was used (Illumina). Hybridization of labeled cRNA to the BeadChip, and washing and scanning were performed according to the Illumina BeadStation 500x manual. Essentially, the amplified, biotin-labeled human cRNA samples were resuspended in a solution of Hyb E1 buffer (Illumina) and 25% (v/v) formamide at a final concentration of 25 ng/µL. cRNA (1.5 µg of each) were hybridized. Hybridization was allowed to proceed at 55 C, for 18 h after which, the bead array matrix was washed for 10 min with 1x High temperature buffer (Illumina), followed by a subsequent 10-min wash in Wash E1BC buffer. The arrays were then washed with 100% ethanol for 10 min to strip off any remaining adhesive on the chip. A 2-min E1BC wash was performed to remove residual ethanol. The arrays were blocked for 5 min with 1% (w/v) casein-PBS (Pierce). The array signal was developed via 10-min incubation with Streptavidin-Cy3 at a final concentration of 1 µg/mL solution of (GE Healthcare) in 1% casein-PBS blocking solution. The Human Expression BeadChip was washed a final time in Wash E1BC buffer for 5 min and subsequently dried via centrifugation for 4 min at a setting of 275 rcf. The arrays were scanned on the Illumina BeadArray Reader, a confocal-type imaging system with 532 (Cye3) nm laser illumination. The bead signals were computed with weighted averages of pixel intensities, and local background is subtracted. Sequence-type signal was calculated by averaging corresponding bead signals with outliers removed (using median absolute deviation). Preliminary data analysis and QC was carried out using the BeadStudio software (Illumina). Simultaneous normalization of multiple microarrays was done using the mloess method (18).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
HDAC inhibition down-regulates hTRT presentation. Previously, it was shown that TSA treatment increases the transcription and expression of hTRT in normal (19, 20) and cancer (21) cells. Consistent with this report, we found that treatment with TSA induced an increase in the transcriptional activity of the hTRT gene in the HLA-A2+/hTRT+ lymphoblastoid JY cell line. In repeated independent experiments, specific mRNA amplification was consistently visible after 30 minutes, peaked at 18 hours, and persisted for an additional 24 hours after TSA removal (data not shown). We reasoned that the increase in hTRT transcription could yield an increase in the number of HLA-A2/hTRT peptide complexes displayed at the cell surface (antigen presentation). Therefore, we investigated complex formation between the HLA-A2 molecule and two high affinity (~4 nmol/L) hTRT peptides, p540 and p865. Detection of the two complexes was performed using two human recombinant Fab antibodies, 4A9, which is specific for the HLA-A2/p540 complex, and 3H2, which is specific for the HLA-A2/p865 complex (15). Notably, each antibody only recognized the complex formed with the homologous hTRT peptide. Complexes with hybrid peptides comprising 5 amino acids residues of the homologous peptide and 4 amino acid residues from a different hTRT peptide did not mediate binding (Fig. 1A ). Surprisingly, in several independent flow cytometry analyses, surface staining by either 4A9 or 3H2 was substantially reduced (Fig. 1B) in TSA-treated JY cells compared with untreated cells. Diminished surface expression of the HLA-A2/hTRT peptide complex persisted for 24 h after TSA removal (data not shown). Surface expression of HLA-A2 molecules was similar in treated and untreated cells (Fig. 1C), although in 3 of 10 experiments, a decrease (10–20%) in mean fluorescence intensity was observed after TSA treatment.


Figure 1
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Flow cytometry analysis of decreased presentation of HLA-A2/hTRT peptide complexes by TSA treatment. A, flow cytometry analysis of the specificity of 4A9 and 3H2 antibodies for HLA-A2/hTRT complexes. Left, 4A9 antibody (2 µg) in 100 µL was used to stain unpulsed TAP-deficient T2 cells or cells pulsed with 10 µg/mL of p540 or the hybrid peptides p540/p865 (ILAKFFLLV) and p540/p49 (ILAKFRRRV). Right, 3H2 antibody was similarly used to stain unpulsed TAP-deficient T2 cells or cells pulsed with p865 or the hybrid peptides p865/p540 (RLLVDDLHWL) and p865/p49 (RLVDDRRRV). B, flow cytometry analysis of surface staining for the HLA-A2/p540 and HLA-A2/p865 complex in TSA-treated JY cells and stained by either antibody 4A9 or 3H2 (2 µg per reaction). JY cells were treated for 8 or 18 h as indicated. Analyses were performed as detailed in Materials and Methods. C, flow cytometry analysis of surface staining for the HLA-A2 in TSA-treated JY cells. Analyses were performed as detailed in Materials and Methods. Results are representative of multiple independent experiments.

 
To better visualize the reduction in antigen presentation, we used deconvolution microscopy focusing on the HLA-A2/p540 complex because this has a longer half-life (~6 hours) than the HLA-A2/p865 complex (11). In untreated JY cells, HLA-A2/p540 complexes were visible with a bright surface granular staining (Fig. 2A, left ). However, fewer complexes were seen in TSA-treated versus untreated cells (Fig. 2A, right). A comparative, quantitative analysis of the corresponding images showed a 3-fold decrease in the intensity of complex staining in TSA-treated cells (Fig. 2B). The same quantitative difference was documented in three independent experiments. A higher magnification of single cells further shows this phenomenon (Fig. 2C).

Decreased antigen presentation was not unique to JY cells because TSA treatment (18 hours) of the HLA-A2+/hTRT+ melanoma cell line 629.38 resulted again in transcriptional activation of hTRT (Fig. 3A ) and, importantly, in diminished surface expression of the complex (Fig. 3B). TSA treatment increased somewhat the detection of HLA-A2 molecules at the cell surface (Fig. 3C). Collectively, whereas a decrease in presentation is not supported by a decrease in surface expression of HLA-A2 molecules, the data show that chromatin changes after HDAC inhibition by TSA promote hTRT transcription but decrease presentation of MHC complexes formed with high affinity hTRT peptides.

Gene profiling analysis. MHC I/peptide complexes originate in the endoplasmic reticulum (ER) where nascent MHC I molecules are loaded with peptides that are generated in the proteasome and are translocated into the ER by the transporter associated with antigen processing (TAP). Because the MHC I/peptide cargo in the ER is a function of peptide input from the cytosol and the local synthesis of MHC I molecules, we reasoned that the 3-fold lower antigen presentation concomitant with an increase in antigen expression in the cytosol could have several explanations. For instance, TSA could inhibit the proteasome and/or TAP, hence diminishing assembly of MHC I/peptide complexes in the ER. To this end, we tested TAP expression levels by flow cytometry in TSA-treated cells and found no change. This lead to the further possibility that proteasome, or events in the ER-Golgi, could impair peptide generation, MHC I/peptide complex maturation, and/or egress from the ER. To this end, the effect of TSA on surface expression of the HLA-A2/p540 complex was compared with that of lactacystin, a selective inhibitor of the proteasome, and BFA, an ER -> Golgi transport inhibitor that also inhibits MHC I/peptide complex presentation. Lactacystin, markedly reduced presentation compared with untreated as well as TSA-treated JY cells (Fig. 4A ). BFA (18-hour treatment) blocked completely surface expression of the complex (Fig. 4A). Interestingly, BFA treatment for 4 hours did not affect the cell surface expression of the MHC/peptide complex (data not shown), in agreement with the half-life (~6 hours) of the complex. This suggests that the diminished presentation associated with HDAC inhibition by TSA could be due to either a partial defect of the proteasome, a defect in ER -> Golgi transport, or both.


Figure 4
View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. HDAC inhibition by TSA modulates the processing and presentation pathway in JY cells. A, deconvolution microscopy visualization of surface expression of the HLA-A2/p540 complex by antibody 4A9 (2 µg per reaction) on JY cells treated (18 h) with either lactacystin (LC; 3.8 µg/mL), TSA (1 µg/mL), or BFA (10 µg/mL). B, gene array profiling of JY cells treated with TSA (18 h). Total RNA was extracted and analyzed using Illumina bead arrays. Levels of gene expression were compared with untreated JY cells. In the clustergrams, genes are grouped into proteasome genes; ER stress responsive genes; ER->Golgi resident and trafficking genes; and MHC I–related genes. The fold changes are noted on the respective color scales. Two independent experiments were performed and shown.

 
To distinguish between these possibilities, a genome-wide expression profiling of TSA-treated (18 hours) JY cells was performed to see which gene pathway(s) might be involved in reducing antigen presentation by HDAC inhibition. Proteasome genes. Peptides for the MHC I are generated mainly by the proteasome and other cytoplasmic proteases. The 26S proteasome that is responsible for the degradation of poly-ubiquinated proteins is composed of outer structural {alpha}-subunits and inner proteolytic β-subunits that are encoded by different genes. The microarray analysis of the proteasome in TSA-treated JY cells showed an overall down-regulation of β-subunit genes (Fig. 4B), with β-subunits 8 (PSMB8) and 10 (PSMB10) being down-regulated the most. Of note, gene expression of the cytoplasmic peptidase TPPII was unchanged (data not shown), suggesting that the down-modulation of the β-subunits of the proteasome could be responsible, in part, for a downstream diminished loading of peptides (i.e., p540 and p865) onto the MHC I molecules in the ER. ER stress genes. ER stress responsive genes, such as DNA damage–inducible transcript 3 (Ddit3), PP1RS15A (Gadd34), Heat shock protein 5 (Grp78, Bip), Wolfram syndrome 1 (Wfs), activating transcription factor 4 (ATF4), and calreticulin, were all up-regulated (Fig. 4B). This indicates that a downstream effect of HDAC inhibition is the induction of ER stress. This is not surprising because TSA is known to transcriptionally modulate many (2%) genes in malignant human cells (22), and supports the notion that TSA-mediated apoptosis of tumor cells may be mediated by ER stress. Consistent with the induction of ER stress is the transcriptional activation of proinflammatory genes such as tumor necrosis factor-{alpha} (x7) and IL-23 p19 (x4; data not shown), which are up-regulated during ER stress (23). ER and Golgi resident and trafficking related genes. Analysis of these genes showed an overall minor increase in ER->Golgi trafficking genes indicating that the diminished presentation of HLA-A2/p540 complexes by TSA treatment is unlikely to be due to a decrease in ER->Golgi trafficking. MHC I antigen presentation–related genes. Transcriptional analysis of the MHC I pathway was performed to identify changes that could explain the diminished surface expression of the HLA-A2/p540 complex. Overall, MHC I genes were unchanged, although a slight negative trend was observed (Fig. 4B). The increase in Bap31 (an ER resident type II transmembrane protein exerting quality control on MHC I/peptide complexes) and the decrease in Der1 (an ER retrotranslocation transmembrane protein) suggest a program to conserve MHC I molecules. In contrast, tapasin, a key regulator of TAP and MHC I peptide binding, and a gatekeeper of MHC I/peptide complex stability (24), was markedly diminished. Consistently, transcription of the tapasin-like gene, which shares similarity at the tridimensional level with tapasin, was also markedly down-regulated. Finally, additional members of the peptide loading complex and MHC I maturation (TAP1, TAP2, calnexin, and ERp57) showed little change, if any, with the exception of calreticulin (x2 increase).

HDAC inhibition affects the proteasome and tapasin. Gene profiling analysis proved of key value in assessing the possible downstream targets of TSA with respect self-tumor antigen presentation. First, we noted that wide spectrum HDAC inhibition down-regulated transcription of most genes of the proteasome complex corresponding to a global decrease in proteasome activity of ~30% (Fig. 5A ). Because hTRT proteolysis requires ubiquination and is mediated by the proteasome (25), the decrease in proteasome activity by HDAC inhibition is consistent with the decrease in presentation of hTRT. Because peptide generation in the proteasome is the first step in antigen processing, the observed diminished presentation of hTRT may reflect in part an effect on the proteasome. Second, HDAC inhibition promoted ER stress, something not observed previously after TSA treatment. Several considerations suggest that ER stress may not play a crucial and direct role in diminishing presentation of hTRT because (a) hTRT transcription increases after TSA treatment, whereas the unfolded protein response (ER stress) in general diminish transcription (26), and (b) treatment with thapsigargin (an inhibitor of the Ca2+ pump and inducer of ER stress) did not diminish the surface expression of the MHC I/peptide complex (data not shown). Third, a defect in ER->Golgi transport of MHC I/peptide complexes is also unlike because most genes involved in transport and trafficking underwent discrete up-regulation upon TSA treatment, ruling out defects in ER->Golgi transport. Finally, selected changes in the MHC I–related genes were observed with tapasin being markedly down-regulated. Tapasin down-regulation observed in the array analysis (Fig. 4B) was confirmed by qRT-PCR (Fig. 5B). Tapasin is involved in optimal loading of MHC I molecules with peptide and in retaining unstable MHC I/peptide complexes in the ER, whereas favoring egress of stable, high-affinity complexes (27), and in the retrieval of COPI vesicles containing MHC I molecules loaded with unstable peptides (28). Thus, its down-regulation can explain the diminished antigen presentation. Because other genes related to MHC I/peptide complex biogenesis, such as calreticulin, Grp78/Bip, and COPI, were all moderately up-regulated, it seems as if the down-regulation of tapasin affected the quality control and sorting of MHC I/peptide complexes in and from the ER, hence playing a central role in the diminished presentation of high affinity HLA-A2/hTRT complexes.


Figure 5
View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Analysis of proteasome function and the expression of tapasin after TSA treatment. A, reduction of proteasome activity by TSA. JY cells were treated (18 h) with TSA (1 µg/mL), sodium butyrate (20 µg/mL), or lactacystin (10 µmol/L), and the activity of the proteasome was quantified using Proteasome-Glo assay. Cells in 5 µL of DMSO (untreated) served as a control. Tests were done in triplicate as indicated in Materials and Methods. B, levels of tapasin gene expression as determined by qPCR. Tapasin levels in JY cells were determined at 8 and 18 h after TSA treatment and compared with untreated cells. GAPDH is shown as a control.

 
Reduced killing of TSA-treated tumor cells by CD8 T cells. Recognition of the MHC I/peptide complex is the structural basis for specific killing of tumor cells by cytotoxic T lymphocytes. To assess whether the decreased presentation by TSA treatment had an effect on tumor target recognition and lysis, we performed killing assays using three different HLA-A2+/hTRT+ cancer cells (JY, Mel629.38, and LnCap) as targets and in vitro generated human p540-specific CTL as the effectors. The percent lysis of TSA-treated T2 cells pulsed with p540 was similar to that of untreated targets (Fig. 6A ), suggesting that TSA does not interfere with cell surface MHC loading with peptide, nor does it change the susceptibility to lysis of these tumor cells. Interestingly, after TSA treatment the lysis of all three tumor cells was markedly diminished compared with untreated cells (Fig. 6A). The specificity of the CTL clone for the HLA-A2/p540 complex was shown by a canonical cold target inhibition assay (11). As shown, the lysis of JY cells was specifically and completely competed for by T2 cells pulsed with p540 but not T2 cells pulsed with the control HIV gag peptide (Fig. 6B). To further prove the functional relevance of HDAC inhibition–induced reduced presentation of p540, new cold target inhibition experiments were performed using TSA-treated JY, 629, and LnCap cells as hot targets. We reasoned that if TSA treatment diminishes presentation of the HLA-A2/p540 complex rendering cells less susceptible to lysis by CTL, inhibition by cold targets pulsed with p540 would be more effective diminishing killing of hot targets. As shown, killing of TSA-treated targets was markedly reduced in the presence of p540-pulsed cold inhibitors compared with control cold inhibitors (Fig. 6C and D). Of note, this effect was dose dependent and almost complete at the highest cold/hot ratio. Collectively, these results show that HDAC inhibition decreases presentation, and this negatively affects killing by specific CTL.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
We show that HDAC inhibition in human cancer cells diminishes the presentation of high affinity peptides of telomerase reverse transcriptase, a self-tumor antigen. HDAC inhibition also down-regulates proteasome genes and tapasin, a key ER-associated gene of the class I pathway. Importantly, we show that subsequent to these changes, tumor cells are killed less efficiently by cytotoxic T lymphocytes. Collectively, our data suggest that epigenetic modifications of tumor cells can affect self-tumor antigens presentation.

Although HDAC inhibitors alter 2% to 5% of the genome depending on the cell type and the inhibitor (22, 29), we could identify transcriptional changes that directly relate to the MHC I pathway of antigen presentation provisionally excluding defects in transport along the secretory pathway. In light of our findings, we propose that modifications associated with HDAC inhibition by TSA modulate hTRT presentation involving (a) down-regulation of proteasome's genes with diminished proteasome function (~30%) and (b) down-regulation (~80%) of tapasin. Because tapasin impairs the quality control and sorting mechanisms for high-affinity peptide complexes, a decrease in its expression and function would effect on the MHC I peptide repertoire, favoring the egress of MHC I molecules bound to unstable (low affinity) peptides. Several facts favor this hypothesis. Tapasin-deficient mice have defective immune responses with an altered MHC I/peptide repertoire (30). Deficiency of tapasin in mice results in the recognition of epitopes associated with impaired peptide processing (31). MHC I/peptide presentation in tapasin (–/–) human cells is subverted qualitatively and quantitatively (32). Thus, by altering the composition of the MHC I/peptide complexes in favor of low affinity peptide complexes, and by decreasing antigen presentation, HDAC inhibition reduces presentation of high-affinity self-antigen peptides in tumor cells. This scenario assumes that the abundance of hTRT relative to other ubiquinated proteins remains the same before and after HDAC inhibition. Furthermore, although the main effect of TSA at the transcriptional level is through histone acetylation, a direct effect on tapasin by acetylation of the double lysine motif at the COOH terminus (33) cannot be ruled out.

That HDAC inhibition decreases the presentation of a self-tumor antigen is new and at variance with recent findings that mouse tumor cell lines treated with TSA undergo the up-regulation of genes of the MHC Class I pathway, including TAP and tapasin (34). A discrepancy between the present report and the studies in mouse cells is unclear and may reflect species differences. Of note, however, antigen presentation in mouse tumor cells was not studied with the aid of an anticomplex antibody as it was done here. Finally, the down-regulation of tapasin documented here is surprising in light of the mouse data. Because HDAC inhibition opens the chromatin and transcriptionally activates many genes, down-regulation of tapasin may be the indirect effect of genes not yet identified. Future studies will need to address this issue.

hTRT is a self-antigen in human cancer cells (35) and it may be involved in immune surveillance because cancer patients, but not normal individuals, carry hTRT-specific CD8 T cells in their blood (14). Here, chromatin acetylation by HDAC inhibition leads unexpectedly to decreased antigen presentation of hTRT and diminished killing by human CTL (Fig. 6A), suggesting that this may be yet another mechanism of immune evasion. Because previous studies in normal human cells showed that hTRT plays an important role in resetting chromatin architecture during DNA replication (36), the finding that HDAC inhibition diminishes hTRT presentation suggests that changes in the equilibrium between hTRT and chromatin that is normally in place to preserve the DNA damage response (37), is a fail-safe mechanism to oppose recognition of tumor cells by adaptive cellular T-cell responses, which are the main effector immune defense against cancer.

Taken together, the above considerations suggest that HDAC inhibition in tumor cells could lead to evasion of immune surveillance (38). Several reports indicate that tapasin is down-regulated in tumors (3944), implying that its down-regulation may somehow be linked with poor presentation of tumor antigens as well as poor tumor protection by T cells in vivo. Interestingly, impaired tapasin expression in tumor cells can be reversed by IFN{gamma} (42), excluding genetic alterations as the underlying molecular mechanism of such deficiency. Because IFN{gamma} may impart epigenetic modifications to chromatin, it seems as if epigenetic changes are at the origin of this type of immune evasion by cancer cells. The above considerations on potential evasion of immune surveillance need, however, to be seen in the broader context of the reported increase in expression of ligands for the NKG2D receptor on human NK cells by HDAC inhibitors (45, 46). Higher expression of these ligands would increase susceptibility to killing by NK cells, hence counterbalancing the diminished killing by cytotoxic T cells.

Whether or not the epigenetic regulation of hTRT presentation reported herein applies to other self-tumor antigens remains untested. Of interest, however, TSA activates the transcription of the melanoma-associated MAGE A1, A2, A3, and A12 genes in a variety of different cell lines (47). To conclude, the demonstration that epigenetic changes by HDAC inhibition affect the presentation of hTRT, a universal self-tumor antigen, suggests a potentially important new link between epigenetic regulation of cancer cells and immune surveillance (38).


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
No potential conflicts of interest were disclosed.


    Acknowledgments
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Drs. J. Feramisco (Moores Cancer Center Imaging Facility) for help with the deconvolution microscopy experiments and invaluable advice in their interpretation, S. Wain-Hobson (Istitut Pasteur) for comments on the manuscript, and J. Lapira for technical help. X.C. Gonzalez is grateful to the UCSD Alliance for Graduate Education and the Professoriate (NSF-9978892), and the Training Program in Basic Genetics (NIH/National Institute of General Medical Sciences 5 T32 GM08666-07).


    Footnotes
 
Note: I. Pellicciotta and X. Cortez-Gonzalez contributed equally to this work.

Received 3/17/08. Revised 6/17/08. Accepted 7/15/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Feinberg AP. Phenotypic plasticity and the epigenetics of human disease. Nature 2007;447:433–40.[CrossRef][Medline]
  2. Bird A. Perceptions of epigenetics. Nature 2007;447:396–8.[CrossRef][Medline]
  3. Polevoda B, Sherman F. N-terminal acetyltransferases and sequence requirements for N-terminal acetylation of eukaryotic proteins. J Mol Biol 2003;325:595–622.[CrossRef][Medline]
  4. Kouzarides T. Histone acetylases and deacetylases in cell proliferation. Curr Opin Genet Dev 1999;9:40–8.[CrossRef][Medline]
  5. Fraga MF, Ballestar E, Villar-Garea A, et al. Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer. Nat Genet 2005;37:391–400.[CrossRef][Medline]
  6. Zou YR, Sunshine MJ, Taniuchi I, Hatam F, Killeen N, Littman DR. Epigenetic silencing of CD4 in T cells committed to the cytotoxic lineage. Nat Genet 2001;29:332–6.[CrossRef][Medline]
  7. Avni O, Lee D, Macian F, Szabo SJ, Glimcher LH, Rao A. T(H) cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nat Immunol 2002;3:643–51.[Medline]
  8. Gasser S, Orsulic S, Brown EJ, Raulet DH. The DNA damage pathway regulates innate immune system ligands of the NKG2D receptor. Nature 2005;436:1186–90.[CrossRef][Medline]
  9. Khan AN, Magner WJ, Tomasi TB. An epigenetically altered tumor cell vaccine. Cancer Immunol Immunother 2004;53:748–54.[Medline]
  10. Vonderheide RH, Hahn WC, Schultze JL, and Nadler LM. The telomerase catalytic subunit is a widely expressed tumor-associated antigen recognized by cytotoxic T lymphocytes. Immunity 1999;10:673–9.[CrossRef][Medline]
  11. Minev B, Hipp J, Firat H, Schmidt JD, Langlade-Demoyen P, Zanetti M. Cytotoxic T cell immunity against telomerase reverse transcriptase in humans. Proc Natl Acad Sci U S A 2000;97:4796–801.[Abstract/Free Full Text]
  12. Finnin MS, Donigian JR, Cohen A, et al. Structures of a histone deacetylase homologue bound to the TSA and SAHA inhibitors. Nature 1999;401:188–93.[CrossRef][Medline]
  13. Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer 1997;33:787–91.[CrossRef][Medline]
  14. Filaci G, Fravega M, Setti M, et al. Frequency of telomerase-specific CD8+ T lymphocytes in cancer patients. Blood 2006;107:1505–12.[Abstract/Free Full Text]
  15. Lev A, Denkberg G, Cohen CJ, et al. Isolation and characterization of human recombinant antibodies endowed with the antigen-specific, major histocompatibility complex-restricted specificity of T cells directed toward the widely expressed tumor T-cell epitopes of the telomerase catalytic subunit. Cancer Res 2002;62:3184–94.[Abstract/Free Full Text]
  16. Yin L, Laevsky G, Giardina C. Butyrate suppression of colonocyte NF-{kappa} B activation and cellular proteasome activity. J Biol Chem 2001;276:44641–6.[Abstract/Free Full Text]
  17. Eberwine J, Yeh H, Miyashiro K, et al. Analysis of gene expression in single live neurons. Proc Natl Acad Sci U S A 1992;89:3010–4.[Abstract/Free Full Text]
  18. Sasik R, Woelk CH, Corbeil J. Microarray truths and consequences. J Mol Endocrinol 2004;33:1–9.[Abstract]
  19. Takakura M, Kyo S, Sowa Y, et al. Telomerase activation by histone deacetylase inhibitor in normal cells. Nucleic Acids Res 2001;29:3006–11.[Abstract/Free Full Text]
  20. Cong YS, Bacchetti S. Histone deacetylation is involved in the transcriptional repression of hTERT in normal human cells. J Biol Chem 2000;275:35665–8.[Abstract/Free Full Text]
  21. Hou M, Wang X, Popov N, et al. The histone deacetylase inhibitor trichostatin A derepresses the telomerase reverse transcriptase (hTERT) gene in human cells. Exp Cell Res 2002;274:25–34.[CrossRef][Medline]
  22. Mitsiades N, Mitsiades CS, Richardson PG, et al. Molecular sequelae of histone deacetylase inhibition in human malignant B cells. Blood 2003;101:4055–62.[Abstract/Free Full Text]
  23. Wheeler M, Rizzi M, Sasik R, et al. KDEL-retained antigen in B lymphocytes induces a pro-inflammatory response. A possible role for ER stress in adaptive T cell immunity. J Immunol 2008;181:256–64.[Abstract/Free Full Text]
  24. Cabrera CM. The double role of the endoplasmic reticulum chaperone tapasin in peptide optimization of HLA class I molecules. Scand J Immunol 2007;65:487–93.[CrossRef][Medline]
  25. Kim JH, Park SM, Kang MR, et al. Ubiquitin ligase MKRN1 modulates telomere length homeostasis through a proteolysis of hTERT. Genes Dev 2005;19:776–81.[Abstract/Free Full Text]
  26. Harding HP, Calfon M, Urano F, Novoa I, Ron D. Transcriptional and translational control in the Mammalian unfolded protein response. Annu Rev Cell Dev Biol 2002;18:575–99.[CrossRef][Medline]
  27. Howarth M, Williams A, Tolstrup AB, Elliott T. Tapasin enhances MHC class I peptide presentation according to peptide half-life. Proc Natl Acad Sci U S A 2004;101:11737–42.[Abstract/Free Full Text]
  28. Paulsson KM, Kleijmeer MJ, Griffith J, et al. Association of tapasin and COPI provides a mechanism for the retrograde transport of major histocompatibility complex (MHC) class I molecules from the Golgi complex to the endoplasmic reticulum. J Biol Chem 2002;277:18266–71.[Abstract/Free Full Text]
  29. Johnstone RW. Histone-deacetylase inhibitors: novel drugs for the treatment of cancer. Nat Rev Drug Discov 2002;1:287–99.[CrossRef][Medline]
  30. Garbi N, Tan P, Diehl AD, et al. Impaired immune responses and altered peptide repertoire in tapasin-deficient mice. Nat Immunol 2000;1:234–8.[CrossRef][Medline]
  31. van Hall T, Wolpert EZ, van Veelen P, et al. Selective cytotoxic T-lymphocyte targeting of tumor immune escape variants. Nat Med 2006;12:417–24.[CrossRef][Medline]
  32. Purcell AW, Gorman JJ, Garcia-Peydro M, et al. Quantitative and qualitative influences of tapasin on the class I peptide repertoire. J Immunol 2001;166:1016–27.[Abstract/Free Full Text]
  33. Paulsson KM, Jevon M, Wang JW, Li S, Wang P. The double lysine motif of tapasin is a retrieval signal for retention of unstable MHC class I molecules in the endoplasmic reticulum. J Immunol 2006;176:7482–8.[Abstract/Free Full Text]
  34. Khan AN, Gregorie CJ, Tomasi TB. Histone deacetylase inhibitors induce TAP, LMP, Tapasin genes and MHC class I antigen presentation by melanoma cells. Cancer Immunol Immunother 2008;57:647–54.[CrossRef][Medline]
  35. Zanetti M, Hernandez X, Langlade-Demoyen P. Telomerase reverse transcriptase as target for anti-tumor T cell responses in humans. Springer Semin Immunopathol 2005;27:87–104.[CrossRef][Medline]
  36. Masutomi K, Possemato R, Wong JM, et al. The telomerase reverse transcriptase regulates chromatin state and DNA damage responses. Proc Natl Acad Sci U S A 2005;102:8222–7.[Abstract/Free Full Text]
  37. d'Adda di Fagagna F, Teo SH, Jackson SP. Functional links between telomeres and proteins of the DNA-damage response. Genes Dev 2004;18:1781–99.[Abstract/Free Full Text]
  38. Burnet FM. Immunological surveillance in neoplasia. Transplant Rev 1971;7:3–25.[Medline]
  39. Delp K, Momburg F, Hilmes C, Huber C, Seliger B. Functional deficiencies of components of the MHC class I antigen pathway in human tumors of epithelial origin. Bone Marrow Transplant 2000;25 Suppl 2:S88–95.[CrossRef][Medline]
  40. Li J, Schuler-Thurner B, Schuler G, Huber C, Seliger B. Bipartite regulation of different components of the MHC class I antigen-processing machinery during dendritic cell maturation. Int Immunol 2001;13:1515–23.[Abstract/Free Full Text]
  41. Seliger B, Atkins D, Bock M, et al. Characterization of human lymphocyte antigen class I antigen-processing machinery defects in renal cell carcinoma lesions with special emphasis on transporter-associated with antigen-processing down-regulation. Clin Cancer Res 2003;9:1721–7.[Abstract/Free Full Text]
  42. Seliger B, Schreiber K, Delp K, et al. Downregulation of the constitutive tapasin expression in human tumor cells of distinct origin and its transcriptional upregulation by cytokines. Tissue Antigens 2001;57:39–45.[CrossRef][Medline]
  43. Seliger B, Wollscheid U, Momburg F, Blankenstein T, Huber C. Coordinate down-regul ation of multiple MHC class I antigen processing genes in chemical-induced murine tumor cell lines of distinct origin. Tissue Antigens 2000;56:327–36.[CrossRef][Medline]
  44. Seliger B, Wollscheid U, Momburg F, Blankenstein T, Huber C. Characterization of the major histocompatibility complex class I deficiencies in B16 melanoma cells. Cancer Res 2001;61:1095–9.[Abstract/Free Full Text]
  45. Armeanu S, Bitzer M, Lauer UM, et al. Natural killer cell-mediated lysis of hepatoma cells via specific induction of NKG2D ligands by the histone deacetylase inhibitor sodium valproate. Cancer Res 2005;65:6321–9.[Abstract/Free Full Text]
  46. Diermayr S, Himmelreich H, Durovic B, et al. NKG2D ligand expression in AML increases in response to HDAC inhibitor valproic acid and contributes to allorecognition by NK-cell lines with single KIR-HLA class I specificities. Blood 2008;111:1428–36.[Abstract/Free Full Text]
  47. Wischnewski F, Pantel K, Schwarzenbach H. Promoter demethylation and histone acetylation mediate gene expression of MAGE-A1, -A2, -A3, and –A12 in human cancer cells. Mol Cancer Res 2006;4:339–49.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pellicciotta, I.
Right arrow Articles by Zanetti, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pellicciotta, I.
Right arrow Articles by Zanetti, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online