Cancer Research Prevention Award  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 467, January 15, 2008. doi: 10.1158/0008-5472.CAN-07-0782
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Correction (v68,p1609)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, X.
Right arrow Articles by Band, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, X.
Right arrow Articles by Band, V.

Cell, Tumor, and Stem Cell Biology

Cyclooxygenase-2 Expression during Immortalization and Breast Cancer Progression

Xiangshan Zhao1, Monica Goswami1,3, Nidhi Pokhriyal1, Hui Ma1, Hongyan Du4, Jun Yao6, Thomas A. Victor3, Kornelia Polyak6, Charles D. Sturgis3, Hamid Band2,5 and Vimla Band1,5

Divisions of 1 Cancer Biology and 2 Molecular Oncology, Department of Medicine, 3 Department of Pathology, and 4 Center for Outcome Research and Education, Evanston Northwestern Healthcare Research Institute and Feinberg School of Medicine; 5 Department of Biochemistry, Molecular Biology and Cell Biology, Northwestern University, Evanston, Illinois; and 6 Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts

Requests for reprints: Vimla Band, Department of Genetics, Cell Biology & Anatomy, University of Nebraska Medical Center, DRC 6th Floor, 985805 Nebraska Medical Center, Omaha, NE 68198-5805. Phone: 402-559-8565; Fax: 402-559-7328; E-mail: vband{at}unmc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of molecular aberrations in premalignant human mammary epithelial cells (hMEC), the precursors for breast cancers, is a central goal in breast cancer biology. Recent studies implicated expression of cyclooxygenase 2 (COX-2) as a marker to identify precursor cells for breast cancer. In this study, we analyzed COX-2 expression in preselection and postselection hMEC cells and observed similar COX-2 levels in both cells. Interestingly, immortalization of postselection cells using various methods leads to a dramatic decrease in COX-2 expression. Similar to immortal cells, the majority of breast cancer cell lines expressed low levels of COX-2 protein. Finally, analyses of COX-2 expression in a series of specimens from reduction mammoplasty, adenosis, ductal carcinoma in situ, and infiltrating ductal carcinoma showed down-regulation of COX-2 expression during tumor progression. Importantly, down-regulation of COX-2 using small interfering RNA in cells showed no effect on cell proliferation, anchorage-independent growth, migration, or invasion. These results show that (a) COX-2 overexpression does not seem to predict a breast cancer precursor cell and does not provide advantage for the cell to be transformed; (b) inhibition of COX-2 does not affect hMEC growth and oncogenic behavior in the conditions analyzed; and (c) COX-2 expression is decreased in breast cancer cell lines and cancer specimens as compared with normal mammary epithelial cells. [Cancer Res 2008;68(2):467–75]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Breast cancer is a heterogeneous disease with multiple genetic alterations that influence tumor growth, progression, and metastasis (1). However, breast tumors with favorable clinical and pathobiological features are potentially curable given the availability of several effective treatment modalities and early diagnosis (1). Therefore, defining the biological markers that would provide prognostic assessment and predict treatment response at the time of diagnosis is of critical importance in breast cancer management.

Identification of molecular aberrations in premalignant mammary epithelial cells (hMEC) that are presumed precursors for nearly all breast cancers is a central goal in breast cancer biology. Normal hMECs derived from reduction mammoplasty and cultured in vitro grow for about 15 to 20 population doublings and then senesce (26). However, in some cases, an occasional cell population emerges that continue to further grow for 30 to 60 population doublings before senescence (26). This process of emergence of cells is also known as self-selection; the cells are termed as preselection cells whereas those that emerge after selection are called postselection cells (26). Postselection cells have been reported to lose the expression of p16INK4a, a cyclin-dependent kinase inhibitor (7). Recent microarray comparison of preselection with postselection hMECs revealed higher levels of cyclooxygenase 2 (COX-2) in postselection cells (8), and COX-2–positive foci have also been observed in healthy mammary tissues (9). Furthermore, postselection cultures showed increased angiogenic and invasion-associated factors (8). Based on these findings, COX-2 was suggested as a marker of precursors and risk of breast cancer (8, 9). The correlation of COX-2 expression and clinical course of breast cancer, however, is quite controversial (914). Based on the information of the lack of spontaneous transformation of hMECs in vitro (26), which express high COX-2 protein (8), the risks associated with long-term chemoprevention in healthy women, the recent appreciation of cardiovascular risks of COX-2 inhibitor use, and the fact that COX-2 is a stress and inflammation induced protein (15, 16), it is essential to establish whether COX-2 expression in fact contributes to oncogenic conversion of hMECs. Furthermore, the literature presents conflicting reports on the levels of COX-2 expression and breast cancer progression and its use as a marker for disease-free survival or overall survival (914).

In this study, we present evidence that COX-2 expression is similar in preselection and postselection hMECs. Importantly, the majority of immortal hMECs and breast cancer cell lines showed a dramatic decrease in COX-2 expression as compared with normal MECs. Importantly, immunohistochemical analyses of breast tissues showed that 100% normal reduction mammoplasty specimens expressed high levels of COX-2 protein, whereas only 60% of adenosis expressed COX-2 protein. More importantly, 49% of ductal carcinoma in situ (DCIS) and 43% infiltrating ductal carcinomas (IDC) showed similar levels of COX-2 as normal mammary epithelium, whereas more than 50% of tumors showed significantly decreased levels of COX-2 protein. Analyses of COX-2 mRNA using quantitative reverse transcription-PCR (RT-PCR) also showed the same pattern. Importantly, knockdown of COX-2 by short hairpin RNA (shRNA) in breast cells did not affect cell proliferation, anchorage-independent growth, migration, or invasion. These results show that COX-2 expression is not a marker for tumor precursor cells and does not provide advantage for further transformation in hMECs, and its expression is decreased in immortal and tumor cells in vitro and in breast tumor progression in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines. Normal hMECs (70N, 76N, and 81N), human papillomavirus 16 (HPV16) E6–immortalized hMECs (70NE6, 76NE6, and 81NE6), HPV16 E7–immortalized hMECs (76NE7), HPV16 E6E7–immortalized hMECs (16A5), milk-derived hMECs (M2E6E7 and M3E6E7), human telomerase catalytic subunit TERT–immortalized hMECs (70NTERT, 76NTERT, and 81NTERT), mutant p53–immortalized hMECs (del239, R175H, and R249S from parental 76N cells), radiation-immortalized hMECs (76R-30), and breast cancer cell lines (21PT, 21NT, 21MT-1, and 21MT-2) were established in our laboratory as previously described (1720). The immortalized human hMECs (184A1, 184B5, and MCF-10A) and breast cancer cell lines (MDA-MB-231, MDA-MB-468, MDA-MB-436, MDA-MB-435s, MDA-MB-453, BT474, BT549, ZR75-1, ZR75-30, T47D, SKBR-3, Hs578T, and MCF-7) were obtained from the American Type Culture Collection. Normal and immortal hMECs were maintained in DFCI-1 medium, as previously described (17). All tumor cell lines were grown in {alpha}-MEM or {alpha}-MEM supplemented with hydrocortisone and epidermal growth factor (EGF).

Western blot analysis. Sixty micrograms of total protein from cell lysates were run on SDS-PAGE gel (15%, 12%, or 10.5%) and transferred onto polyvinylidene difluoride membrane. Monoclonal antibodies (mAb) against human COX-2 (Cayman Chemical Co.), {alpha}-tubulin (Sigma) and p16 (Santa Cruz Biotechnology, Inc.) and rabbit polyclonal antibodies against human HER2 (Santa Cruz Biotechnology), human epidermal growth factor receptor (EGFR; Santa Cruz Biotechnology), and hTERT (Rockland) were used for immunoblotting, followed by horseradish peroxidase (HRP)–conjugated goat anti-mouse antibody (Pierce Biotechnology) or goat anti-rabbit antibody (Bio-Rad Laboratories).

Immunofluorescence. Cells were fixed on coverslips with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked in 5% goat serum, and then incubated with mouse anti-human COX-2 mAb (1:500) and rabbit anti-human p16 polyclonal antibody (1: 500; Santa Cruz Biotechnology) for 16 h, followed by incubation with Alexa Flour 488 goat anti-mouse (1:1,000) or Alexa Flour 594 goat anti-rabbit (1:1,000) antibody for 2 h. After staining with 4',6-diamidino-2-phenylindole, the slides were mounted and observed under a Nikon TE200-U inverted microscope equipped with an ORCA-ER charge-coupled device camera controlled with Metamorph software (Universal Imaging Corp.).

Northern blotting. Total RNA from normal cells was extracted with Trizol and 30 µg of total RNA were separated on 1.2% formaldehyde denaturing agarose gel and transferred onto Hybond-N nylon membrane and hybridized with [32P]dCTP-labeled COX-2 probe.

Immunohistochemistry. Specimens were collected from the Evanston Northwestern Healthcare without individual identifiers using protocols approved by the Institutional Review Boards. Three to four microsections were deparaffinized in xylene, rehydrated in descending alcohols, and treated in a digital pressure cooker containing citrate buffer (pH 6.0; DakoCytomation, S1699). Endogenous peroxidase activity was blocked by incubation in 3% hydrogen peroxide for 10 min. Sections were rinsed in TBST and incubated for 5 min in protein block buffer (DakoCytomation X0909). Sections were stained with COX-2 mouse mAb at a 1:200 dilution for 30 min. After being rinsed in TBST, sections were incubated with antimouse (DakoCytomation K4007) secondary antibody conjugated to a dextran-labeled polymer and HRP for 15 min. Sections were washed in TBST and incubated in 3,3'-diaminobenzidine solution for 7 min, rinsed in distilled water, and counterstained in Mayer's hematoxylin (Sigma MHS-80) for 7 min, followed by treatment of sections in ammonia water (4 mL 28% ammonium hydroxide in 1,000 mL of distilled water) for 1 min and rinsing in distilled water. Sections were rehydrated and cleared through ethanol and xylene and mounted with cover glass using a xylene-based mounting medium. The COX-2 staining intensity (0, no staining; 1, weak; 2, moderate; 3, strong) was evaluated by three independent observers with light microscopy, including two pathologists (Dr. Monica Goswami and Charles Sturgis).

Quantitative PCR to determine relative COX-2 mRNA levels. Specimens were collected from the Brigham and Women's Hospital without individual identifiers using protocols approved by the Institutional Review Boards of Dana-Farber Cancer Institute. Total mRNAs were extracted from Ber-Ep4 purified normal luminal epithelial cells and macroscopically dissected tumor cells based on adjacent H&E staining slides and cDNAs were synthesized by reverse transcription (21). Quantitative PCR was done on ABI 7500 QPCR machine using ABI SYBR green PCR master mix per manufacturer's instructions (Applied Biosystems). The cycling conditions were 8 min at 95°C followed by 40 cycles of 15 s at 95°C plus 1 min at 58.5°C. The relative gene copy numbers toward normal luminal epithelial cells and cancer cells were calculated by the comparative Ct method (22) using normalization control ribosomal protein L39 (RPL39). The primer sequences used in this study were COX-2 forward, TGAGCATCTACGGTTTGCTG; COX-2 reverse, TGCTTGTCTGGAACAACTGC; RPL39 forward, CAGCTTCCCTCCTCTTCCTT; and RPL39 reverse, GCCAGGAATCGCTTAATCC.

Starvation and EGF treatment. Cells were grown in DFCI-1 medium that contains 12.5 ng/mL EGF (17) and starved in growth factor–deprived DFCI-3 (D3) medium (17) for 72 h and then stimulated with 12.5 ng/mL EGF; cells were harvested at indicated times and analyzed by Western blotting.

shRNA and retroviral infections. The COX-2–specific shRNA1 (oligo sense, 5'-GATCCCCGATTATGTGCAACACTTGATTCAAGAGATCAAGTGTTGCACATAATCTTTTTGGAAA-3'; oligo antisense, 5'-AGCTTTTCCAAAAAGATTATGTGCAACACTTGATCTCTTGAATCAAGTGTTGCACATAATCGGG-3'), shRNA2 (oligo sense, 5'-GATCCCCGGCTATCACTTCAAACTGATTCAAGAGATCAGTTTGAAGTGATAGCCTTTTTGGAAA-3'; oligo antisense, 5'-AGCTTTTCCAAAAAGGCTATCACTTCAAACTGATCTCTTGAATCAGTTTGAAGTGATAGCCGGG-3'), shRNA3 (oligo sense, 5'-GATCCCCGCCCTATGAATCATTTGAATTCAAGAGATTCAAATGATTCATAGGGCTTTTTGGAAA-3'; oligo antisense, 5'-AGCTTTTCCAAAAAGCCCTATGAATCATTTGAATCTCTTGAATTCAAATGATTCATAGGGCGGG-3'), shRNA1 scrambled (oligo sense, 5'-GATCCCCGGTTAAAACCTTACGATGTTTCAAGAGAACATCGTAAGGTTTTAACCTTTTTGGAAA-3'; oligo antisense, 5'-AGCTTTTCCAAAAAGGTTAAAACCTTACGATGTTCTCTTGAAACATCGTAAGGTTTTAACCGGG-3'), and shRNA2 scrambled (oligo sense, 5'-GATCCCCGATACGTTCCAACGATCTATTCAAGAGATAGATCGTTGGAACGTATCTTTTTGGAAA-3'; oligo antisense, 5'-AGCTTTTCCAAAAAGATACGTTCCAACGATCTATCTCTTGAATAGATCGTTGGAACGTATCGGG-3') were annealed and cloned into the BglII and HindIII sites of pSUPER.retro vector. Retroviruses were produced by transient transfection, as previously described (23). After infection, the cells were selected and maintained in selection medium.

Cell proliferation assay. 184B5 and Hs578T (5 x 104) or 21MT (2 x 105) cells were plated in T25 flasks (in triplicates); 4 days later, cells were counted and plated again in 25-cm2 flasks at the original density. Cells deprived of growth factors by culturing in D3 were trypsinized and plated in T25 flasks (2 x 104 per flask). The cells were grown in D3 plus EGF (12.5 ng/mL) medium.

Transwell migration assay. The migration assay was done using BD BioCoat wells (8 µm pore size; BD Biosciences). Cells expressing COX-2 shRNA and scrambled shRNA were trypsinized and plated in low-serum-containing (1% FCS) {alpha}-MEM medium (Hs578T and 21MT-1). Cells [4 x 104 (21MT-1) or 2 x 104 (Hs578T) per well] were added to the top chambers of the transwell. After 2 h, 10% FCS–containing {alpha}HE medium was added to the lower chamber and incubated for a further 24 h (21MT-1) or 6 h (Hs578T). The membrane was then stained with Diff-Quik Stain Set kit (Dade Behring, Inc.). Cells that migrated through the membrane were counted using an inverted tissue culture microscope.

Invasion assay. The invasion assay was done by using BD Matrigel invasion chamber (8 µm pore size; BD Biosciences). Cells were trypsinized and plated as above. The cells [4 x 104 (21MT-1) or 1 x 104 (Hs578T) per well] were added to the top chambers of the transwell as above. Two hours later, 10% FCS–containing {alpha}HE medium was added to the lower chamber and cells were incubated for 96 h (21MT-1) or 48 h (Hs578T). Membranes were stained and cells counted as above.

Anchorage-independent growth assay. Anchorage-independent assay was done using six-well plates. Each well contained 1 mL of 0.6% agarose in growth medium as the bottom layer and 1 x 105 cells in 2 mL of 0.3% agarose in growth medium as the top layer. The pictures were taken at 21 days after cell seeding.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
COX-2 protein is overexpressed in both preselection (p16-positive) and postselection (p16-negative) hMECs. Based on the recent publication that p16/COX-2+ postselection cells represent precursor of breast cancer (8), we assessed the expression of p16 and COX-2 in two different hMEC strains preselection and postselection. Surprisingly, we observed that both p16+ (preselection) and p16 (postselection) cells had similar levels of COX-2 expression (Fig. 1A ). E7-expressing 70N cells (19) were used as positive control for p16 expression (Fig. 1A).


Figure 1
View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. A similar level of COX-2 protein is expressed in preselection and postselection hMECs. A, preselection and postselection cells from two hMEC strains, 70N and 81N, were analyzed by Western blotting for the levels of COX-2 and p16 protein. 70N.E7 was used as p16-positive control. {alpha}-Tubulin immunoblotting was used as a loading control. B, cells [MCF-7, COX-2, and p16 negative, used as negative control; 70NE7, p16-positive cells used as p16-positive control; 70N and 81N (preselection and postselection hMECs)] were immunostained with anti–COX-2 mAb (green) and anti-p16 rabbit polyclonal antibody (red). Cells were observed under a Nikon TE200-U inverted microscope equipped with an ORCA-ER charge-coupled device camera controlled by MetaMorph software. Region Measurements program in MetaMorph software was used for computerized quantification of COX-2 and p16 staining. Right, results shown as average intensity per cell.

 
Considering that preselection and postselection cells can still be a mixture of heterogenous hMECs, we examined expression of COX-2 and p16 by immunofluorescence. As expected, MCF-7 cells used as negative control showed lack of expression of both p16 and COX-2, whereas 70NE7 cells used as positive control showed expression of both p16 and COX-2 proteins (Fig. 1B). Consistent with our Western blotting results (above), preselection hMECs were uniformly positive for both p16 and COX-2 proteins (Fig. 1B). These results show that both p16 and COX-2 proteins were expressed in preselection cells, and therefore postselection cells could arise from COX-2–expressing preselection cells rather than COX-2–negative cells turning into COX-2–positive cells after the selection.

COX-2 protein is down-regulated in most immortal cell lines. Next, we examined if indeed COX-2 expression in hMECs can serve as a marker for breast cancer and would thus provide high susceptibility to postselection cells for immortalization and further transformation. Thus, we examined COX-2 expression in immortal cells derived from postselection parental cells using different agents. Surprisingly, nearly all immortal cells had barely detectable levels of COX-2 protein. These included hMECs derived from reduction mammoplasty as well as from milk specimen and immortalized with HPV16 E6, E7, or E6 + E7; mutant p53; TERT; and benzopyrene treatment (Fig. 2A ; refs. 1721, 24). Because immortalization by various genes does not involve a common biochemical pathway, immunoblotting with anti-TERT antibody served as a control (Fig. 2A).


Figure 2
View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. COX-2 expression is reduced in most immortal breast cell lines and breast cancer cell lines. A, Western blotting of postselection normal (70N, 81N, and 76N), mutant p53–immortalized (mut1, del239, mut2, R175H, mut3, and R249S), 76E6E7 (E6 + E7 immortalized), M2E6E7 and M3E6E7 (two milk-derived cells immortalized by E6 + E7), 76NE6, 70NE6, and 81NE6 (three E6 immortalized), 70NE7 (E7 immortalized), 76NTERT, 70NTERT, and 81NTERT (three TERT immortalized), 184A1 and 184B5 (two benzopyrene immortalized), MCF-10A (a spontaneously immortalized cell line from benign breast tissue), and MCF-7 (a pleural effusion derived breast cancer) cells for COX-2 (top) and hTERT (bottom). B, immunofluorescence of several immortal cell lines was done as in Fig. 1B. C, indicated breast cancer cell lines were Western blotted with anti–COX-2, anti-HER2, or anti-EGFR antibodies. {alpha}-Tubulin antibody served as loading control. D, total RNA extracted from normal (76N), immortal (76NR30, 16A5, and 184B5), and tumor (21MT-1, MDA-MB-436, MDA-MB-468, MDA-MB-453, BT474, SKBR-3, and MCF-7) cells was separated on formaldehyde denaturing agarose gel, transferred onto Hybond-N nylon membrane, and probed with [32P]dCTP-labeled COX-2 or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probes (top). The denaturing RNA gel stained with ethidium bromide shows the integrity of mRNA samples (bottom).

 
Given the fact that hMECs cultures may be heterogeneous, we assessed p16 and COX-2 expression in TERT- or E6-immortalized hMECs by immunofluorescence (Fig. 2B). Correlating with Western blotting results, immunofluorescence analyses showed barely detectable expression of COX-2 and p16 in the cells. These results further show that COX-2 expression in immortal cells is lower than in parental cells.

The majority of breast cancer cell lines have low level of COX-2 protein. Next, we examined a number of breast cancer cell lines including four breast cancer cell lines (21MT-1, ZR75-30, BT474, and SKBR-3) known to express high level of ErbB-2. Similar to immortal cells, the majority (15 of 17) of breast cancer cell lines showed barely detectable levels of COX-2 protein whereas 21MT-1 and Hs578T cells showed relatively high levels of COX-2 expression as compared with postselection normal hMECs (Fig. 2C). Of the four ErbB2-positive breast cancer cell lines, only the 21MT-1 cells showed high COX-2 expression (Fig. 2C). Based on the known status of ErbB2 and EGFR expression in these breast cancer cell lines, immunoblotting with anti-ErbB2 and anti-EGFR antibodies served as controls in these experiments (Fig. 2C). To further substantiate these results, we analyzed COX-2 mRNA levels in selected sets of COX-2–positive and COX-2–negative immortal and cancer cell lines by Northern blot analysis. As expected, COX-2 mRNA levels well correlated with protein expression (Fig. 2D), suggesting that the decrease in COX-2 protein is at the transcriptional level.

COX-2 expression is decreased during tumor progression. Given the fact that we observed decreased levels of COX-2 protein in immortal and tumor breast cell lines, we carried out a stringent analysis of antibody used in our experiments. These included testing several commercially available anti–COX-2 antibodies: rabbit polyclonal (Cayman), rabbit monoclonal (Abcam), goat polyclonal (Santa Cruz Biotechnology), goat polyclonal (Santa Cruz Biotechnology), and goat polyclonal (Santa Cruz Biotechnology) in Western blotting and immunofluorescence staining. None of these five antibodies work in Western blotting and also are not specific for cell staining (data not shown). The only antibody that is widely used and was used in our experiments above is mouse monoclonal COX-2 antibody from Cayman that showed one specific band (from 16 to 250 kDa) in normal mammary epithelial cells (Supplementary Fig. S1). Next, we overexpressed COX-2 protein in MCF-7 cells and also down-regulated COX-2 protein in Hs578T cells and carried out Western blot analyses. As expected, only one specific band of COX-2 protein was seen in the expected lanes (Supplementary Fig. S1). Not only in Western blotting but also immunofluorescence staining analyses of these cells showed that this antibody recognizes specific COX-2 protein (Supplementary Fig. S2). Furthermore, staining of sections cut from paraffin-embedded MCF-7 cells expressing COX-2 confirmed that this antibody is specific for immunohistochemical staining (Fig. 3A ).


Figure 3
View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. COX-2 mRNA and protein expression is decreased in breast tumor specimens in vivo. A, Cayman COX-2 mAb is specific for immunohistochemical staining. MCF-7 cells that stably overexpress COX-2 or vector were fixed with 4% paraformaldehyde overnight. The fixed cells were resuspended in agarose (1% in PBS) at 60°C. The cells in coagulated agarose were embedded in paraffin. Sections cut from paraffin-embedded MCF-7-Vector and MCF-7-COX-2 and sections from normal reduction mammoplasty, DCIS, or IDC tissue blocks were stained with Cayman mAb or normal mouse IgG1 (as negative control). The sections were counterstained in Mayer's hematoxylin to show nuclear staining (blue color). Pictures were taken with a 40x objective. B, representative examples of immunohistochemical staining of COX-2 in sections from human breast normal reduction mammoplasty, adenosis, DCIS, or IDC shown in Table 1. Pictures were taken with a 40x objective. C, COX-2 staining intensity was increased in adjacent normal epithelium tissue surrounding tumors in three independent specimens. Arrows, the normal adjacent epithelium that illustrates more intense COX-2 staining than the adjacent cancer (arrowheads). Pictures were taken with 20x and 40x objectives. D, total mRNAs were extracted from BerEP4 purified normal epithelial cells and macroscopically dissected tumor cells based on adjacent H&E slides. Quantitative PCR was used to determine the mRNA expression profile of COX-2 in normal breast tissue and tumor specimen. COX-2 mRNA expression of the samples was normalized to RPL39. Normal: N2 and N4; IDC: BWH-T1, BWH-T3, BWH-T8, BOT169, IDC1, MGH-T3, MGH-T4, C2, C3, C6, C7, C10, C22, C26, C27, C35, C36, C39, and C47; invasive lobular cancer (ILC): C13; IDC + ILC: BWH-T7 and BWH-T15; metastasis: C27.

 

View this table:
[in this window]
[in a new window]

 
Table 1. COX-2 expression in breast cancer progression

 
Based on this rigorous testing for specificity of the antibody, we assessed the expression levels of COX-2 in a set of breast tissue specimens by immunohistochemistry (Fig. 3A and B). A clear high staining with anti–COX-2 antibody was seen in normal ducts as compared with low COX-2 staining in DCIS and IDC (Fig. 3B), whereas control normal mouse IgG1 showed no staining (Fig. 3A). As summarized in Table 1 , reduction mammoplasty specimens showed high expression of COX-2, whereas adenosis, DCIS, and IDC samples showed variable expression with the majority of cases showing low or lack of COX-2 protein. These observations were further strengthened by higher COX-2 expression in normal epithelium adjacent tissues surrounding tumor in three independent specimens (Fig. 3C). Consistent with our findings, Shim et al. (9) also observed increased COX-2 staining in adjacent normal epithelium surrounding DCIS. Analyses of the relationship between COX-2 expression and histopathologic features of the tumors (ErbB2, grade, estrogen receptor, and progesterone receptor) failed to show statistically significant associations (data not shown).

Next, we determined if loss of COX-2 expression in breast cancer specimens is at the mRNA or protein level. We thus carried out quantitative RT-PCR analyses from an independent set of tumors because the specimens used for immunohistochemistry were archived formalin-fixed paraffin-embedded samples, from which we could not obtain high-quality mRNA or successful in situ hybridization despite several attempts. Quantitative RT-PCR results showed that normal MECs express high level of COX-2 mRNA, whereas most of the tumors express low level of COX-2 mRNA (Fig. 3D). These results and the experiments in Fig. 2 clearly support our immunohistochemistry data and suggest that COX-2 expression is transcriptionally down-regulated in breast cancers. Taken together, these results clearly show that COX-2 expression does not correlate with breast tumor progression.

COX-2 expression is regulated by growth condition. Next, we examined if the expression of COX-2 varies in different culture conditions. For this purpose, we first deprived cells of growth factors by culturing in D3 (17) and then stimulated them with epidermal growth factor. Notably, in each case, when cells were cultured in complete medium or were deprived of growth factors, COX-2 expression was low, whereas addition of EGF dramatically increased the levels of COX-2 protein in a time-dependent manner (Fig. 4A ). These results show that COX-2 expression depends on culture conditions and may explain discrepancies in the literature. These results are consistent with recent findings (25).


Figure 4
View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. COX-2 expression is growth factor dependent and down-regulation of COX-2 has no effect on cell proliferation. A, immortal breast cell lines (76NE6, 76NTERT, and Mutp53-1: p53del239) were grown in DFCI-1 (D) medium that contains 12.5 ng/mL EGF (17) and starved in D3 medium (17) for 72 h and then stimulated with 12.5 ng/mL EGF; cells were harvested at indicated time points and analyzed for COX-2 and {alpha}-tubulin (used as loading control) by Western blotting. B, three shRNAs against COX-2 or two scrambled shRNAs were designed and cloned into pSUPER.retro vector. The immortal hMEC 184B5 and breast cancer cell lines Hs578T and 21MT-1 cells infected with retroviral supernatants. After selection, the cells were analyzed for COX-2 expression by Western blotting (B) or proliferation assays (C and D). For proliferation assay, 5 x 104 (184B5 and Hs578T) or 2 x 105 (21MT-1) cells expressing scrambled shRNA1, shRNA2, COX-2 shRNA1, COX-2 shRNA2, or COX-2 shRNA3 were plated in 25-cm2 flasks (triplicates); 4 d later, cells were counted and plated again in 25-cm2 flasks at the original density (such procedure was repeated four times). The number of viable cells was measured by trypan blue exclusion method. Columns, mean of four independent experiments each done in triplicates; bars, SD (C). D, indicated cells were starved in D3 medium for 3 d and then stimulated with 12.5 ng/mL EGF. Cells were then harvested at indicated times and one set of cells was analyzed for COX-2 expression by Western blotting. Phospho-Akt shows starvation and EGF stimulation was as expected. The second set of cells was plated in T25 flasks (2 x 104 per flask). The number of viable cells was measured by trypan blue exclusion method at 2, 4, 6, and 8 d. For each time point, cells from six flasks were counted.

 
COX-2 down-regulation does not influence proliferation or malignant phenotype of cells. Although there are COX-2 inhibitors available, it is now well recognized that COX-2 inhibitors are not highly specific for COX-2 (26, 27). Thus, to assess if down-regulation of COX-2 expression influences proliferation of cells, we first generated three constructs expressing shRNA against COX-2 and two constructs with scrambled shRNA. As shown in Fig. 4B, cells stably expressing shRNA1 or shRNA2 showed a dramatic reduction in the levels of COX-2 protein, whereas shRNA3 had little effect on COX-2 expression. As controls, both scrambled shRNA–expressing cells showed no change in COX-2 protein expression.

We then assessed the effect of reducing COX-2 expression on cell proliferation. As seen in Fig. 4C, no significant effect on cell proliferation was observed on reduction in COX-2 protein. Next, we examined if decreased levels of COX-2 protein influences growth factor–stimulated proliferation. For this purpose, we first synchronized the immortal 184B5 cells expressing scrambled shRNA or shRNA against COX-2 by growth factor deprivation followed by stimulation with EGF over hours, and then cultured these cells for days and measured proliferation. EGF response was seen by increase in phospho-Akt as expected (Fig. 4D). Consistent with experiments above, no change in proliferation was observed (Fig. 4D). Similar response to colony formation assays was observed (data not shown).

Next, we assessed the effect of COX-2 knockdown on the malignant phenotype of cells. 21MT-1 and Hs578T cells stably expressing COX-2 shRNA or scrambled shRNA were analyzed for their ability to grow in an anchorage-independent manner and their capability to migrate and invade. As shown in Fig. 5 , no significant difference was noted in cells expressing COX-2 shRNA in comparison with cells that express scrambled shRNA. Wound healing assay for migration also did not show any difference (data not shown). These results show that down-regulation of COX-2 in breast cancer cells does not influence the malignant phenotypes that we analyzed.


Figure 5
View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. COX-2 knockdown does not affect migration, invasion, and anchorage-independent growth. A, migration assay using transwell. COX-2 shRNA–expressing cells were trypsinized and suspended in medium and plated on the upper chamber. Cells that migrated through the membrane were counted using an inverted tissue culture microscope. Relative migration was determined by comparing the amount of migration obtained from shRNA-expressing cells to that obtained from scrambled shRNA1-expressing cells. Columns, mean of four independent experiments each done in triplicates; bars, SD. B, invasion assay. The cells were plated as above. The cells that invaded through the membrane were counted using an inverted tissue culture microscope. Relative invasion was determined as above. Columns, mean of four independent experiments each done in triplicates; bars, SD. C, soft agar assay. COX-2 shRNA–expressing Hs578T cells were plated as described in Materials and Methods. The pictures were taken at 21 d after cell seeding. Experiments were repeated at least thrice and a representative experiment is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
For more than two decades, normal hMECs established from reduction mammoplasty specimens have provided great models of human epithelial cells to understand the mechanisms of epithelial cell transformation (28, 29). We and others have shown that when hMECs were cultured in serum-free or low-serum conditions, initial outgrowth of cells from organoids is heterogeneous and these cells proliferate for 10 to 15 population doublings followed by senescence (26). However, in some cases, a morphologically homogeneous population of cells emerges that then continue to proliferate further for 30 to 50 population doublings before senescence. This process is known as selection or M0 stage and cells before selection are called "early passage or preselection cells" and cells that emerge after selection are called "late passages or postselection cells" (19). Recently, postselection cells are also termed as "variant human mammary epithelial cells" (30). We and others have shown that hMECs do not exhibit spontaneous immortalization (1720, 29, 31); however, both preselection and postselection cells can be immortalized by a number of viral and chemical agents (19, 32) and activated oncogenes, such as mutant p53 (33) and cellular genes Bmi-1 (34) and ZNF217 (35). It was noticed that in each case, the cells that were immortal had low expression of p16 due to hypermethylation of the promoter of the CDKN2A gene. This led investigators to hypothesize that the cells with p16 hypermethylation may represent precursor cells for breast cancer (7, 30, 36). Further studies showed that cells with hypermethylation of p16 were present in vivo in normal and benign mammary tissues, suggesting that a p16-negative population may be present in preselection cells to begin with. Recently, Crawford et al. (8) carried out microarray analysis of preselection and postselection cells and identified COX-2 gene as one of the genes that were overexpressed in postselection cells. The authors showed that postselection cells have more angiogenic and invasive capability as compared with preselection cells and thus concluded that COX-2 expression may provide susceptibility to transformation.

Considering our long-standing interest in transformation of postselection cells, we examined if indeed COX-2 expression in hMECs can serve as a marker for breast cancer and would thus provide high susceptibility to postselection cells for immortalization and further transformation. Surprisingly, however, we found that cells grown in our culture conditions express similar levels of COX-2 in both preselection and postselection stages and this was despite of their being p16 negative or p16 positive. Furthermore, most immortal cells expressed much lower levels of COX-2 protein rather than the expected higher levels if these cells represented precursors of breast cancer. Furthermore, majority of breast cancer cell lines also expressed low levels of COX-2 protein. At present, we cannot explain the discrepancy of our results with that of Crawford et al. (8) except that their culture conditions were different than ours and COX-2 expression is known to change with growth factors, although in our system both preselection and postselection cells are grown under identical conditions.

The role of COX-2 in breast cancer is highly controversial (37, 38). Parrett et al. (39) detected COX-2 mRNA expression in 13 of 13 human breast tumors compared with no detectable expression in normal human breast tissue, and observed a correlation between COX-2 expression and increasing tumor cell mass. On the other hand, Hwang et al. (40) found that only 2 of the 44 tumor samples expressed COX-2. Cejas et al. (41) found that COX-2 mRNA and protein were overexpressed in nontumor ductal epithelium as compared with invasive ductal carcinoma.

Based on such controversial data, we opted to assess the levels of COX-2 protein in a set of specimens. Consistent with our experimental models of normal, immortal, and breast tumor cell lines, we observed that literally 100% of reduction mammoplasty specimens and >60% of adenosis expressed high levels of COX-2, whereas only 50% of DCIS and IDC had similar levels of COX-2 and the other 50% showed barely detectable levels of COX-2 protein. We further confirmed that COX-2 expression was decreased at the level of mRNA by real-time PCR analysis. We thus conclude that COX-2 expression is not higher during breast tumor progression.

Some studies reported COX-2 expression correlates with ErbB2 status. High levels of COX-2 protein were detected in 14 of 15 HER2/neu-overexpressing breast cancers. In contrast, COX-2 was detected only in 4 of 14 HER2/neu-negative breast cancers (42). In DCIS, COX-2 expression was associated with higher cellular proliferation rate, and nuclear grade with estrogen receptor negativity and HER2 positivity (13). In contrast, in a study of 57 primary breast carcinomas, 14 DCIS found no significant correlation between COX-2 and HER2 expression. However, overexpression of HER2 in MCF-7 cells was shown to up-regulate COX-2 (43). Davies et al. (12) and Witton et al. (14) did not observe significant correlation between COX-2 and HER2. In our study, 52 of 108 IDC samples were ErbB2 positive. However, 21 of these 52 showed COX-2 expression similar to normal cells, whereas the remaining 31 samples showed decreased levels of COX-2 expression. Mantel-Haenszel {chi}2 test (44) showed that there was no correlation between HER2 expression and COX-2 expression. With regard to the overall or disease-free survival of patients, COX-2 overexpression was found in 48.6% of the tumor samples and was predictive for poor disease-free and overall survival in few studies (911). In contrast, other studies show no significant correlations between COX-2 expression and breast cancer size and grade (12, 14).

Although studies using COX-2 inhibitors known to be not particularly specific for COX-2 inhibition show reduced cell proliferation and tumorigenic behavior of cells (16, 45), recent knockdown of COX-2 with small interfering RNA (siRNA) showed no effect on cell cycle distribution (46). Another study showed no significant difference in the radiosensitivity of cells in which COX-2 was silenced compared with the cells transfected with negative control siRNAs (47). Similarly, another study using tetracycline-inducible (tet-on) COX-2 antisense showed that COX-2 depletion did not induce cell death (26). We did not observe any effect on cell proliferation or oncogenic behavior after knockdown of COX-2 protein. In mouse model, overexpression of COX-2 can induce mammary gland tumorigenesis (48, 49). However, the mammary tumorigenesis occurred with high frequency in MMTV-COX-2 transgenic mice after multiple rounds of pregnancy, indicating that pregnancy greatly increased the tumorigenesis incidence, which is opposite to those observed in women. We believe that studies that show increased tumorigenicity on overexpression in in vivo mouse models may be an indirect effect of COX-2 being involved in inflammatory responses.

We believe that the discrepancies in these studies and our studies could be due to (a) nonspecific reactivity of available anti–COX-2 antibodies for immunohistochemistry of tissue specimens; (b) the sample size in most of these studies is rather small to derive statistical significance; and (c) considering that COX-2 expression is modulated by several factors, such as growth factors, oncogene products, and inflammation, the status of these parameters in a particular tumor sample could influence the expression of COX-2 protein. The discrepancy in expression of COX-2 in preselection or postselection hMECs between our study and that of Crawford et al. (8) can be explained by the possibility that preselection and postselection cells may vary in different specimens or different cells may grow if established in different culture conditions. This hypothesis is supported by our findings and that of others that expression of COX-2 was changed with culture conditions. Considering that COX-2 expression is influenced by several factors and conditions, the expression data should be considered with caution.

In conclusion, we show that COX-2 overexpression does not predict a breast cancer precursor cell and does not provide advantage for the cell to be transformed, and COX-2 expression is decreased in breast cancer cell lines and cancer specimens as compared with normal cells.


    Acknowledgments
 
Grant support: NIH grants CA94143, CA96844, and CA81076 (V. Band) and grants CA87986, CA76118, CA99900, and CA99163 (H. Band); the Duckworth Family Chair for Breast Cancer Research (V. Band); and the Jean Ruggles-Romoser Chair for Cancer Research (H. Band).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

X. Zhao and M. Goswami contributed equally to this work.

Current address for X. Zhao: Department of Genetics, Cell Biology & Anatomy, University of Nebraska Medical Center, Omaha, NE.

Current address for H. Band and V. Band: Eppley Institute for Research in Cancer & Allied Diseases, University of Nebraska Medical Center/Eppley Cancer Center, Omaha, NE.

Received 2/26/07. Revised 9/14/07. Accepted 11/13/07.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Coradini D, Daidone MG. Biomolecular prognostic factors in breast cancer. Curr Opin Obstet Gynecol 2004;16:49–5.[Medline]
  2. Dimri G, Band H, Band V. Mammary epithelial cell transformation: insights from cell culture and mouse models. Breast Cancer Res 2005;7:171–9.[CrossRef][Medline]
  3. Foster SA, Galloway DA. Human papillomavirus type 16 E7 alleviates a proliferation block in early passage human mammary epithelial cells. Oncogene 1996;12:1773–9.[Medline]
  4. Ethier SP, Summerfelt RM, Cundiff KC, Asch BB. The influence of growth factors on the proliferative potential of normal and primary breast cancer-derived human breast epithelial cells. Breast Cancer Res Treat 1991;17:221–30.[CrossRef][Medline]
  5. Yaswen P, Stampfer MR. Molecular changes accompanying senescence and immortalization of cultured human mammary epithelial cells. Int J Biochem Cell Biol 2002;34:1382–94.[CrossRef][Medline]
  6. Romanov SR, Kozakiewicz BK, Holst CR, Stampfer MR, Haupt LM, Tlsty TD. Normalhuman mammary epithelial cells spontaneously escape senescence and acquire genomic changes. Nature 2001;409:633–7.[CrossRef][Medline]
  7. Huschtscha LI, Noble JR, Neumann AA, et al. Loss of p16INK4 expression by methylation is associated with life span extension of human mammary epithelial cells. Cancer Res 1998;58:3508–12.[Abstract/Free Full Text]
  8. Crawford YG, Gauthier ML, Joubel A, et al. Histologically normal human mammary epithelia with silenced p16(INK4a) overexpress COX-2, promoting a premalignant program. Cancer Cell 2004;5:263–73.[CrossRef][Medline]
  9. Shim V, Gauthier ML, Sudilovsky D, et al. Cyclooxygenase-2 expression is related to nuclear grade in ductal carcinoma in situ and is increased in its normal adjacent epithelium. Cancer Res 2003;63:2347–50.[Abstract/Free Full Text]
  10. Spizzo G, Gastl G, Wolf D, et al. Correlation of COX-2 and Ep-CAM overexpression in human invasive breast cancer and its impact on survival. Br J Cancer 2003;88:574–8.[CrossRef][Medline]
  11. Ristimaki A, Sivula A, Lundin J, et al. Prognostic significance of elevated cyclooxygenase-2 expression in breast cancer. Cancer Res 2002;62:632–5.[Abstract/Free Full Text]
  12. Davies G, Salter J, Hills M, Martin LA, Sacks N, Dowsett M. Correlation between cyclooxygenase-2 expression and angiogenesis in human breast cancer. Clin Cancer Res 2003;9:2651–6.[Abstract/Free Full Text]
  13. Boland GP, Butt IS, Prasad R, Knox WF, Bundred NJ. COX-2 expression is associated with an aggressive phenotype in ductal carcinoma in situ. Br J Cancer 2004;90:423–9.[CrossRef][Medline]
  14. Witton CJ, Hawe SJ, Cooke TG, Bartlett JM. Cyclooxygenase 2 (COX2) expression is associated with poor outcome in ER-negative, but not ER-positive, breast cancer. Histopathology 2004;45:47–54.[CrossRef][Medline]
  15. Gislason GH, Jacobsen S, Rasmussen JN, et al. Risk of death or reinfarction associated with the use of selective cyclooxygenase-2 inhibitors and nonselective nonsteroidal antiinflammatory drugs after acute myocardial infarction. Circulation 2006;113:2906–13.[Abstract/Free Full Text]
  16. Howe LR, Subbaramaiah K, Brown AM, Dannenberg AJ. Cyclooxygenase-2: a target for the prevention and treatment of breast cancer. Endocr Relat Cancer 2001;8:97–114.[Abstract]
  17. Band V, Zajchowski D, Kulesa V, Sager R. Human papilloma virus DNAs immortalize normal human mammary epithelial cells and reduce their growth factor requirements. Proc Natl Acad Sci U S A 1990;87:463–7.[Abstract/Free Full Text]
  18. Band V, Zajchowski D, Swisshelm K, et al. Tumor progression in four mammary epithelial cell lines derived from the same patient. Cancer Res 1990;50:7351–7.[Abstract/Free Full Text]
  19. Wazer DE, Liu XL, Chu Q, Gao Q, Band V. Immortalization of distinct human mammary epithelial cell types by human papilloma virus 16 E6 or E7. Proc Natl Acad Sci U S A 1995;92:3687–91.[Abstract/Free Full Text]
  20. Ratsch SB, Gao Q, Srinivasan S, Wazer DE, Band V. Multiple genetic changes are required for efficient immortalization of different subtypes of normal human mammary epithelial cells. Radiat Res 2001;155:143–50.[CrossRef][Medline]
  21. Hu M, Yao J, Cai L, et al. Distinct epigenetic changes in the stromal cells of breast cancers. Nat Genet 2005;37:899–905.[CrossRef][Medline]
  22. Ginzinger DG. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp Hematol 2002;30:503–12.[CrossRef][Medline]
  23. Band V. In vitro models of early neoplastic transformation of human mammary epithelial cells. Methods Mol Biol 2003;223:237–48.[Medline]
  24. Stampfer MR, Bartley JC. Induction of transformation and continuous cell lines from normal human mammary epithelial cells after exposure to benzo[a]pyrene. Proc Natl Acad Sci U S A 1985;82:2394–8.[Abstract/Free Full Text]
  25. Symowicz J, Adley BP, Woo MM, Auersperg N, Hudson LG, Stack MS. Cyclooxygenase-2 functions as a downstream mediator of lysophosphatidic acid to promote aggressive behavior in ovarian carcinoma cells. Cancer Res 2005;65:2234–42.[Abstract/Free Full Text]
  26. Song X, Lin HP, Johnson AJ, et al. Cyclooxygenase-2, player or spectator in cyclooxygenase-2 inhibitor-induced apoptosis in prostate cancer cells. J Natl Cancer Inst 2002;94:585–91.[Abstract/Free Full Text]
  27. Kashfi K, Rigas B. Non-COX-2 targets and cancer: expanding the molecular target repertoire of chemoprevention. Biochem Pharmacol 2005;70:969–86.[CrossRef][Medline]
  28. Band V. Preneoplastic transformation of human mammary epithelial cells. Semin Cancer Biol 1995;6:185–92.[CrossRef][Medline]
  29. Stampfer MR, Yaswen P. Culture models of human mammary epithelial cell transformation. J Mammary Gland Biol Neoplasia 2000;5:365–78.[CrossRef][Medline]
  30. Holst CR, Nuovo GJ, Esteller M, et al. Methylation of p16(INK4a) promoters occurs in vivo in histologically normal human mammary epithelia. Cancer Res 2003;63:1596–601.[Abstract/Free Full Text]
  31. Wazer DE, Chu Q, Liu XL, Gao Q, Safaii H, Band V. Loss of p53 protein during radiation transformation of primary human mammary epithelial cells. Mol Cell Biol 1994;14:2468–78.[Abstract/Free Full Text]
  32. Toouli CD, Huschtscha LI, Neumann AA, et al. Comparison of human mammary epithelial cells immortalized by simian virus 40 T-antigen or by the telomerase catalytic subunit. Oncogene 2002;21:128–39.[CrossRef][Medline]
  33. Cao Y, Gao Q, Wazer DE, Band V. Abrogation of wild-type p53-mediated transactivation is insufficient for mutant p53-induced immortalization of normal human mammary epithelial cells. Cancer Res 1997;57:5584–9.[Abstract/Free Full Text]
  34. Dimri GP, Martinez JL, Jacobs JJ, et al. Bmi-1 oncogene induces telomerase activity and immortalizes human mammary epithelial cells. Cancer Res 2002;62:4736–45.[Abstract/Free Full Text]
  35. Nonet GH, Stampfer MR, Chin K, Gray JW, Collins CC, Yaswen P. The ZNF217 gene amplified in breast cancers promotes immortalization of human mammary epithelial cells. Cancer Res 2001;61:1250–4.[Abstract/Free Full Text]
  36. Foster SA, Wong DJ, Barrett MT, Galloway DA. Inactivation of p16 in human mammary epithelial cells by CpG island methylation. Mol Cell Biol 1998;18:1793–801.[Abstract/Free Full Text]
  37. Egan KM, Stampfer MJ, Giovannucci E, Rosner BA, Colditz GA. Prospective study of regular aspirin use and the risk of breast cancer. J Natl Cancer Inst 1996;88:988–93.[Abstract/Free Full Text]
  38. Harris RE, Namboodiri KK, Farrar WB. Nonsteroidal antiinflammatory drugs and breast cancer. Epidemiology 1996;7:203–5.[Medline]
  39. Parrett ML, Harris HR, Joarder FS, Ross MS, Clausen KP, Robertson FM. Cyclooxygenase-2 gene expression in human breast cancer. Int J Oncol 1997;10:503–7.
  40. Hwang D, Scollard D, Byrne J, Levine E. Expression of cyclooxygenase-1 and cyclooxygenase-2 in human breast cancer. J Natl Cancer Inst 1998;90:455–60.[Abstract/Free Full Text]
  41. Cejas P, Garcia-Cabezas MA, Casado E, et al. Localisation of COX-2 protein is different in breast ductal carcinoma and adjacent non-tumour ductal epithelium. Clin Transl Oncol 2005;7:239–43.[CrossRef][Medline]
  42. Subbaramaiah K, Norton L, Gerald W, Dannenberg AJ. Cyclooxygenase-2 is overexpressed in HER-2/neu-positive breast cancer: evidence for involvement of AP-1 and PEA3. J Biol Chem 2002;277:18649–57.[Abstract/Free Full Text]
  43. Half E, Tang XM, Gwyn K, Sahin A, Wathen K, Sinicrope FA. Cyclooxygenase-2 expression in human breast cancers and adjacent ductal carcinoma in situ. Cancer Res 2002;62:1676–81.[Abstract/Free Full Text]
  44. Agresti A, editor. An introduction to categorical data analysis. New York: John Wiley & Sons, Inc.; 1996.
  45. Rigas B, Kashfi K. Cancer prevention: a new era beyond cyclooxygenase-2. J Pharmacol Exp Ther 2005;314:1–8.[Abstract/Free Full Text]
  46. Denkert C, Furstenberg A, Daniel PT, et al. Induction of G0/G1 cell cycle arrest in ovarian carcinoma cells by the anti inflammatory drug NS-398, but not by COX-2-specific RNA interference. Oncogene 2003;22:8653–61.[CrossRef][Medline]
  47. Palayoor ST, Arayankalayil MJ, Shoaibi A, Coleman CN. Radiation sensitivity of human carcinoma cells transfected with small interfering RNA targeted against cyclooxygenase. Clin Cancer Res 2005;11:6980–6.[Abstract/Free Full Text]
  48. Liu CH, Chang SH, Narko K, et al. Overexpression of Cyclooxygenase-2 is sufficient to induce tumorigenesis in transgenic mice. J Biol Chem 2001;276:18563–9.[Abstract/Free Full Text]
  49. Chang SH, Liu CH, Conway R, et al. Role of prostaglandin E2-dependent angiogenic weitch in cyclooxygenase 2-induced breast cancer progression. Proc Natl Acad Sci U S A 2004;101:591–6.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
Correction: COX-2 Expression Decreases in Breast Cancer Progression
Cancer Res., March 1, 2008; 68(5): 1609 - 1609.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Correction (v68,p1609)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, X.
Right arrow Articles by Band, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, X.
Right arrow Articles by Band, V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online