| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Program in Epithelial Biology and 2 Cancer Biology Program, Stanford University School of Medicine, Stanford, California and 3 Department of Anatomy, University of California, San Francisco, California
Requests for reprints: Howard Y. Chang, Stanford University School of Medicine, 269 Campus Drive, CCSR 2155, Stanford, CA 94305. Phone: 650-736-0306; Fax: 650-723-8762; E-mail: howchang{at}stanford.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Based on the concept that tumor growth may recapitulate many aspects of normal wound healing, we previously identified a wound response gene expression signature that is reactivated in many types of human cancers, including breast, prostate, lung, and gastric cancers (4). The wound signature is composed of 512 genes that defined the transcriptional response of fibroblasts to serum, the soluble fraction of clotted blood. In primary breast cancer, the wound signature provides prognostic risk stratification of metastasis that is more predictive and is independent of traditional criteria, such as lymph node status, grade, and estrogen receptor status (4, 5). Using a new genetic method termed stepwise linkage analysis of microarray signatures (SLAMS), we recently identified coordinate amplification of CSN5 (also known as JAB1 or COPS5, residing on 8q13) and MYC (8q24) as the cause of wound signature activation in human breast cancers (6). Coexpression of CSN5 with MYC is sufficient to induce the wound signature and confer features of transformation to nontransformed mammary epithelial cells, including increased proliferation and matrix invasiveness. These results therefore nominate CSN5 as a candidate oncogene and potential driver of the 8q amplicon in breast cancer.
Although the role of MYC in the progression of many types of cancer has been studied extensively (7), the mechanism of CSN5 action in cancer progression is less well understood. CSN5 protein is overexpressed in many human epithelial cancers, including human breast cancers (8–10). Depletion of CSN5 can inhibit the proliferation of some pancreatic cancer cell lines in vitro (11). However, the genetic context of CSN5 action, its biochemical mode of action, and its role in cancer progression in vivo remain unclear. If we are to target CSN5 rationally in high-risk breast tumors exhibiting 8q amplification and the poor-prognosis wound signature, then a detailed understanding of the oncogenic mechanism of CSN5 is needed.
More than a dozen biochemical activities have been reported for the COP9 signalosome complex (12, 13). CSN5 may exert its oncogenic effects by at least three potential mechanisms, realized when CSN5 resides in distinct macromolecular complexes (Supplementary Fig. S1). First, CSN5 encodes the catalytic component of the COP9 signalosome, a protein complex that regulates cell proliferation, response to extracellular stimuli, cell migration, and DNA damage checkpoints (13). The COP9 signalosome, composed of eight proteins named CSN1 to CSN8, is conserved from yeast to humans and is essential for development in Drosophila and mouse (14–16). A main function of COP9 is to maintain the activity of SCF (SKP1, CUL1, and F-box) and other cullin-RING family E3 ubiquitin ligases. All cullin proteins seem to be covalently modified by the ubiquitin-like protein NEDD8 on a single lysine residue. The COP9 signalosome deneddylates CUL1; this catalytic activity resides in a metalloproteinase-like motif termed the JAMM motif in CSN5 (17). Reconstitution of the NEDD8 isopeptidase activity in vitro requires the entire COP9 signalosome (17). Deneddylation by CSN5 maintains SCF complexes in an active state (6, 18, 19), leading to the ubiquitination and proteasomal degradation of many cellular proteins. Consistent with this model, we previously found that CSN5 enhances the cotranscriptional ubiquitination of MYC that activates the transcriptional activity of MYC on a set of target genes promoting cell proliferation, invasion, and angiogenesis (6).
Second, in a small CSN complex composed of five proteins (CSN4, CSN5, CSN6, CSN7, and CSN8), CSN5 induces the cytoplasmic export and degradation of p27, the cyclin-dependent kinase (CDK) inhibitor that is targeted for destruction by both CSN5 and MYC (via transcription of CUL1; refs. 16, 20–22). Interestingly, the degradation of p27 by the proteasome is mediated by SCFSKP2 (23–25). Thus, two distinct CSN5 activities may sequentially act on p27 for nuclear export and degradation. Third, monomeric CSN5 protein can bind to and modulate the activity of multiple transcription factors and signaling proteins (8, 13). Most relevant to cancer are the interactions with hypoxia-inducible factor-1
(HIF-1
), leading to HIF-1
protein stabilization and increased angiogenic activity (26, 27), and E2F1, leading to selective activation of E2F1-mediated apoptotic activity (28). These activities seem to be independent of the isopeptidase activity because interaction of CSN5 with both HIF-1
and E2F1 is unaffected by the D151N mutation that inactivates the isopeptidase activity (27, 28). In addition, the COP9 signalosome is associated with kinase and deubiquitinase activities, which can potentially initiate oncogenic signaling (12, 29).
In the present study, we evaluate the dosage, genetic context, and specific activities of CSN5 that underlie its oncogenic role using both human and mouse models of breast epithelial transformation by defined genetic elements. Our results provide the first evidence that CSN5 isopeptidase activity is essential for breast cancer proliferation in vivo.
| Materials and Methods |
|---|
|
|
|---|
(R&D Systems) are from the indicated sources. pLXSN-CSN5 (27), pMDM2-Luc, pMDM2-Luc-Mut (30), pMIG, and pMIG-MYC (31) were previously published. pCDNA3.1-HA-CSN5 (Xin Chen, University of California, San Francisco, CA), pLZRS-GFP (Paul Khavari, Stanford University School of Medicine, Stanford, CA), pBabe-MYC (Dean Felsher, Stanford University School of Medicine), pMICD8-MYC, and pMICD8-RASV12 (Suwon Kim, University of California, and Yosef Refaeli, National Jewish Medical and Research Center, Denver, CO) were gifts of the indicated investigators. The CSN5D151N mutation was created by site-directed mutagenesis and verified by sequencing. For cloning into pMIG, HA-CSN5 and HA-CSN5D151N fragments were released by XhoI and SalI digestion and subcloned into XhoI-digested pMIG; for cloning into LZRS, HA-CSN5 and HA-CSN5D151N were cloned into pENTR and subsequently cloned into LZRS using Gateway Technology (Invitrogen). Clones were verified by sequencing and immunoblotting with HA and CSN5 antibodies. All small interfering RNAs (siRNA) were synthesized by Dharmacon. Sequences for GFP (E1; ref. 32) and CSN5 (33) are from published sequences. siMYC was an individual siGENOME duplex (sense sequence: CGACGAGACCUUCAUCAAAUU), whereas siCSN1, siCSN6, and sip27 were SMARTpool siGENOME duplexes from Dharmacon. 3'-Untranslated region (UTR)-specific siCSN5 was designed using Dharmacon siDESIGN center (sense sequence: AGAAGUACUUUACCUGAAAUU).
Cell Culture
PHMLEB and PHMLER cells were a kind gift of Robert Weinberg (Massachusetts Institute of Technology, Cambridge, MA). PHMLEB, PHMLER, and primary HMEC (Cambrex) were propagated in MEGM mammary epithelial cell medium (Cambrex). MCF10A cells [American Type Culture Collection (ATCC)] were propagated in DMEM/F12 (Invitrogen/Cambrex) and 5% fetal bovine serum (FBS) supplemented with epidermal growth factor (20 ng/mL), insulin (10 µg/mL), and hydrocortisone (0.5 µg/mL), and 293 cells (ATCC) were propagated in DMEM and 10% FBS. Retroviral constructs were transfected into amphotropic Phoenix cells (gift of Garry Nolan, Stanford University School of Medicine), and virus-containing supernatants were used to transduce PHMLER and MCF10A cells as described (34). Expression of transduced genes was verified by immunoblotting. siRNAs were transfected into PHMLER cells with Lipofectamine 2000 as described by the manufacturer (Invitrogen); protein knockdown was verified by immunoblotting.
Cell Proliferation, Immunofluorescence, Cell Death, Soft Agar, and Reporter Gene Assays
Cell proliferation and immunofluorescence. Cell proliferation (6) and immunofluorescence (35) were performed as described. For BrdUrd incorporation, cell proliferation was monitored 3 days after siRNA transfection by measuring incorporation of the thymidine nucleotide analogue BrdUrd (Sigma) into DNA with immunofluorescence as described (36). Percentage of BrdUrd-positive cells among >400 4',6-diamidino-2-phenylindole (DAPI)-positive cells in multiple high-power fields was determined. For p27 immunofluorescence, the number of cells with nuclear p27 staining was determined among >160 DAPI-positive cells in multiple high-power fields.
Cell death. Terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) assay for detection of apoptotic DNA fragmentation 3 or 5 days after siRNA transfection was performed per manufacturer's instruction (Roche). Percentage of TUNEL-positive cells among >500 DAPI-positive cells in multiple high-power fields was determined.
Soft agar. Anchorage-independent growth in soft agar was performed as described with minor changes (3). A bottom layer of 0.5% low melting point agar (Invitrogen) in MEGM medium was plated in 6-cm dishes. One day after siRNA transfection, 5 x 104 cells were seeded on top in 0.34% agar. Multiple similarly dense low-power fields were quantified for colonies
100 µm in diameter 7 to 12 days after plating.
Reporter gene. Dual-luciferase assays (Promega) with MDM2-luciferase were performed in 293 cells as described (6).
Microarray Analysis
Array-based comparative genomic hybridization. Genomic DNA from normal male, PHMLEB, and PHMLER cells was isolated with Qiagen Blood & Cell Culture DNA Midi kit. Labeling and hybridization to Stanford cDNA microarrays containing
23,000 genes was performed as described using normal male genomic DNA as reference (37). Array-based comparative genomic hybridization (CGH) of normal male diploid compared with normal female diploid was previously published (38) and downloaded from Stanford Microarray Database.4 Genes selected for analysis had fluorescent hybridization signal at least 1.5-fold over local background in either Cy5 or Cy3 channel. PHMLEB samples were performed in duplicate; PHMLER samples were performed in triplicate. Replicates were averaged, aligned in sequential chromosomal order as described (37), and visualized with CGH-Explorer.5
Gene expression. Total RNA was extracted with Trizol (Invitrogen) from PHMLER cells 2 days after transfection of the indicated siRNAs in duplicate; RNA was amplified using the Ambion MessageAmpII aRNA kit. Amplified total Human Universal Reference RNA (Stratagene) was used as reference. Labeling and hybridization to cDNA microarrays was performed as described (35). Genes selected for analysis had fluorescent hybridization signal at least 1.5-fold over local background in either Cy5 or Cy3 channel and had technically adequate data in at least 60% of experiments. Genes were analyzed by mean value centering within the data set. Wound signature score was calculated for each sample as described (5). Briefly, the wound signature score is the Pearson correlation coefficient of the expression pattern of genes in the wound signature in an experimental sample to the pattern observed for the same genes in serum-stimulated fibroblasts. The change in score is visualized relative to the P value of significance of coregulation as described (6).
PCR and Reverse Transcription-PCR
For quantitative reverse transcription-PCR (RT-PCR) of MYC and CSN5 (primers and Taqman probes from Applied Biosystems), Taqman One-Step RT-PCR kit (Applied Biosystems) was applied to amplified RNA from primary HMEC or PHMLER cells 48 h after siRNA transfection; all samples were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Validation of MYC and CSN5 DNA copy number was performed on genomic DNA isolated from normal male, PHMLEB, and PHMLER cells. DNA copy number was determined by quantitative microsatellite analysis as described (39) with published primers (6).
Mammary Gland Transplants
For Fig. 5B, primary mammary epithelial cells were isolated from the mammary glands (no. 2–5 glands) of 10- to 12-week-old mice, transduced with retrovirus, and transplanted into cleared no. 4 fat pads as previously described (31). For the remaining experiments, we used the following modifications to increase the efficiency of multiplexed gene transfer. After mincing of the isolated tissue, tissue chunks were treated with 0.85 to 1 mg/mL of collagenase for 1.5 h at 37°C. Differential centrifugation was used to separate blood and fibroblast cells from epithelial cells. Specifically, cells were centrifuged for 5 min at 600 x g and then washed thrice for 2 s at 450 x g. The remaining epithelial cells were resuspended in growth medium and then plated on 10-cm plates. Medium was changed every day, and then on day 4, cells were trypsinized for 5 min and the trypsinized cells were removed. The remaining cells were trypsinized for an additional 20 min and then replated for infection. Cells were infected on 2 consecutive days with the indicated retroviruses (multiplicities of infection of 2 or 3 for each virus) as described (34). Cells were grown in fresh medium for an additional day following infection, and then 65 x 104 to 100 x 104 infected cells were injected into cleared inguinal no. 4 fat pads of 3-week-old nu/nu mice. All comparisons were to the contralateral gland taken from the same mouse.
|
, and VEGF protein in paraffin-embedded sections (5 µm) was performed using BioGenex immunohistochemical detection systems per the manufacturer's instructions. A single score resenting the level of GFP staining across each tumor section was determined on a 0 to 3 scale: 0, <10% of cellular areas stained; 1, 10% to 25% of cellular areas stained; 2, 26% to 50% of cellular areas stained; 3, >50% of cellular areas stained. For HA-CSN5D151N–expressing tumors, the same 0 to 3 scoring criteria above were used to determine the level of HA staining in low-power fields (
0.2 cm2 area) across the entire tumor section; the HA staining scores were averaged and then plotted against the relative tumor size compared with the contralateral control tumor, showing a linear regression (R2 = 0.80; P = 0.01). R (correlation value) and P value (one-sided t test) were calculated with WinSTAT (R. Fitch Software). The number of Ki67-positive cells in several high-power fields was counted and averaged (minimum of 600 cells). Analysis of tumor histologic features was performed by two independent reviewers who were not aware of the tumor genotypes. Multiple medium- to high-power fields of H&E-stained sections were scored. Quantification of nuclear to cytoplasmic ratio was determined by measuring the diameter of the nucleus and cytoplasm of >25 cells for each condition. The volumes of the nucleus and cytoplasm were extrapolated [(1/6) x
x diameter3], and the ratios were averaged.
URLs
Full microarray data are available for download at Stanford Microarray Database or Gene Expression Omnibus.6
| Results |
|---|
|
|
|---|
|
|
The isopeptidase activity of CSN5 is required for mammary epithelial transformation. Because CSN5 is found in several distinct macromolecular complexes that have distinct modes of action, we reasoned that an efficient strategy to determine the mechanism of CSN5 action is to dissect the CSN subunit requirement (Supplementary Fig. S1). We chose to analyze CSN1 and CSN6 because CSN1 is only found in the full COP9 complex, whereas CSN6 can be either in the full or small CSN complexes (22). We found that depletion of either CSN1 or CSN6 strongly decreased the proliferation rate and anchorage-independent growth of PHMLER cells (Fig. 3A–C ). The stronger inhibitory effect of CSN1 or CSN6 depletion on cell proliferation is likely explained by more complete protein depletion compared with CSN5 knockdown. Because depletion of either CSN1 or CSN6 led to similar phenotypes as CSN5 normalization, these data suggest that the full COP9 signalosome is required for the transformed phenotypes of PHMLER cells. It is formally possible that CSN1 and CSN6 may have roles independent of CSN5, although biochemical studies indicate that CSN1 and CSN6 are quantitatively associated with CSN5 (22). Consistent with the idea that additional CSN subunits participate in CSN5-amplified breast cancers, analysis of array-based CGH data revealed that genes encoding several CSN subunits, particularly CSN1, CSN6, and CSN7A, are also amplified in a subset of primary human breast cancers (Supplementary Fig. S4).
|
or E2F1 (22, 27, 28). Because the full COP9 complex is required to reconstitute CSN catalytic activity (17), involvement of CSN5 isopeptidase activity would provide further evidence that CSN5 is acting within the full COP9 signalosome. We first analyzed the ability of CSN5D151N to regulate MYC protein stability and MYC target gene activation. In stably transduced MCF10A cells, a nontransformed breast epithelial cell line, wild-type CSN5 decreased MYC protein accumulation [as a result of stimulating MYC turnover (6)], but CSN5D151N had the opposite effect and increased MYC protein accumulation (Fig. 4A , lane 3 versus lane 5 and lane 4 versus lane 6). MYC mRNA level was equivalent in each pair of CSN5 versus CSN5D151N comparisons (data not shown). Based on the known cotranscriptional ubiquitination and turnover of MYC with target gene activation (41), we hypothesized that the isopeptidase-null CSN5D151N will inhibit MYC target gene activation. We previously identified the oncogene MDM2 as a MYC target gene that required CSN5 activity for full activation (6), and we recapitulated the functional collaboration of MYC and CSN5 using an MDM2-luciferase reporter gene assay in 293 HEK cells (Fig. 4B). CSN5 and MYC individually activated the MDM2 promoter and superactivated the promoter in combination. Importantly, a mutation of the E-box binding site for MYC in the MDM2 promoter completely abrogated transcriptional activation by both CSN5 and MYC, indicating that CSN5 likely activates the MDM2 promoter via endogenous MYC (Fig. 4B, lanes 7 and 8). The isopeptidase mutant CSN5D151N failed to stimulate the MDM2 reporter gene and, importantly, completely inhibited the ability of MYC to activate the MDM2 reporter (Fig. 4B, lanes 5 and 6). These results indicate that CSN5 isopeptidase activity is required for MYC protein turnover and activation of certain target genes and further suggest that CSN5D151N acts as a dominant negative with respect to MYC activation.
|
The central role of the CDK inhibitor p27 in limiting cell cycle progression and its conserved regulation by CSN5 isopeptidase activity (13) suggested p27 as a possible target of the oncogenic effects of CSN5 (9, 10). Previous studies revealed that CSN5 is required in mammalian cells for the nuclear export and proteolytic degradation of p27 (20). We found that depletion of CSN5 alone or in combination with MYC increased nuclear p27 protein levels in PHMLER cells (Supplementary Fig. S5). Cell cycle arrest and loss of anchorage-independent growth induced by CSN5 depletion were specifically reversed by concomitant depletion of p27 (Supplementary Fig. S5), suggesting that a key role of CSN5 activation in breast epithelial transformation is the removal of CDK inhibitor p27 to enable unfettered cell proliferation.
CSN5 isopeptidase activity is required for de novo mammary cancer growth evoked by MYC and RAS in vivo. To dissect mechanisms of cancer progression in vivo in greater detail, we transduced genes of interest into primary mammary epithelial progenitor cells by retrovirus-mediated gene transfer followed by transplantation of transduced cells into cleared mammary fat pads to regenerate transgenic mammary glands and breast cancer development (Fig. 5A ) as described previously (31). To control for hormonal and other environmental variations, we transplanted mammary epithelial cells transduced with different genes on opposite sides of the same host animal. Expression of MYC and oncogenic RASV12 in primary mammary progenitor cells gave rise to highly proliferative mammary adenocarcinomas in 100% of mice within 3 weeks (n = 15; Fig. 5B). In contrast, MYC overexpression alone induced ductal hyperplasia without invasion of epithelial cells beyond basement membrane, even after 3 months (n = 7; Fig. 5B), as previously observed (31).
If the collaboration of MYC and RAS in vivo leads to increased requirement of CSN5 isopeptidase activity, as in HMECs, then this rapidly invasive tumor model should be sensitive to inhibition by enforced expression of CSN5D151N. We compared coexpression of MYC and RAS with either vector or HA-tagged CSN5D151N. We found a strong tumor-suppressive effect of CSN5D151N as evidenced by both tumor size reduction and transgene-negative selection. Coexpression of CSN5D151N decreased the tumor size relative to the contralateral vector-expressing lesion (Fig. 5B). Analysis of GFP expression, which marks expression of HA-CSN5D151N or control vector, showed that whereas the vector remained strongly expressed in 90% of the control tumors, all tumors arising from cells transduced with CSN5D151N had greatly diminished or even extinguished expression of this transgene (Fig. 5C). This suggests that CSN5D151N expression was actively selected against, most likely due to the requirement of CSN5 catalytic activity for efficient cell proliferation in mammary cells (Fig. 4D). Further, there was a linear association between the level of HA-CSN5D151N expressed and the size of the resulting tumor: increasing HA-CSN5D151N expression was significantly correlated with reduced tumor size relative to the contralateral vector-expressing tumors (P = 0.01; Fig. 5D). Despite the incomplete CSN5D151N expression throughout the tumors, on average we still observed a 40% decrease in the size of RAS+MYC tumors upon expression of catalytically inactive CSN5 in tumors with HA-CSN5D151N expression (Fig. 5D).
As in PHMLER cells, we found that in vivo expression of CSN5D151N led to decreased proliferation but not increased apoptosis. Ki67 staining showed substantially decreased number of cycling cells in regions with CSN5D151N expression but not in regions where CSN5D151N was lost (Fig. 6A and B
). Staining for cleaved caspase-3, a marker of apoptosis, showed no change in apoptosis on CSN5D151N expression (Fig. 6A). Histologic analysis further showed that whereas the RAS+MYC tumors were pleomorphic with areas of necrosis, and showed high nuclear to cytoplasmic ratio, CSN5D151N-expressing tumors were less necrotic and had significantly lower nuclear to cytoplasmic ratio (Fig. 6A and C; data not shown). Our previous microarray analysis identified the hypoxia-inducible transcription factor HIF-1
as a MYC target gene that was coactivated by CSN5 in human breast cells (6). Accordingly, expression of CSN5D151N in vivo decreased protein expression of HIF-1
and its target gene VEGF, a key factor in tumor angiogenesis (Supplementary Fig. S6; ref. 27). Taken together, these results suggest that the isopeptidase activity of CSN5 is essential for MYC-driven tumor progression in vivo.
|
| Discussion |
|---|
|
|
|---|
Our findings provide two new insights that assist the molecular dissection of cancer genomes. First, the functional interaction between CSN5 and MYC was initially predicted by genetic analysis of gene copy number aberrations linked with the poor-prognosis wound signature (6). The validation of a functional oncogenic and biochemical pathway connecting CSN5 to MYC ubiquitination, target gene activation, and MYC-dependent tumor growth suggests that integrated oncogenomic approaches (such as the SLAMS method) may be useful in deciphering mechanisms of cancer development. Second, the minimal genetic circuitry of human breast epithelial transformation is more complex than previously thought. Increased copy number of CSN5 and MYC is required to maintain the transformed phenotype of PHMLER cells in the face of dysregulated hTERT, Rb, p53, PP2A, and RAS. Detailed genomic studies of other "genetically defined" cancer models (42–45) may uncover key endogenous mutations that complement the transduced genes to achieve transformation.
Because of its frequent overexpression in human cancers, CSN5 has been suggested as a potential drug target (46). 8q amplification encompassing both CSN5 and MYC has been observed in additional tumor types, including prostate, pancreatic, and liver cancer (38, 47, 48), and in vitro studies suggested a role for CSN5 to regulate pancreatic cancer cell proliferation (11). Thus, CSN5 regulation of MYC and cell proliferation may be a common feature of many human cancers. Due to the large number of biochemical activities associated with CSN5 and the COP9 signalosome, it was previously unclear which CSN5 activity should be targeted. Our data suggest that CSN5 isopeptidase activity is a relevant target in breast cancer and potentially other types of human cancers. The isopeptidase activity of CSN5 resides in a zinc metalloproteinase-like domain termed the JAMM motif. The JAMM motif of CSN5 is an attractive therapeutic target because there is much experience in pharmacologic inhibition of metalloproteinases with small-molecule drugs. Indeed, >10 drugs have been approved for human use that target another zinc metalloproteinase, angiotensin-converting enzyme (including popular antihypertensive drugs such as captopril and benazepril; ref. 46). In contrast, inhibition of transcription factors or signaling proteins working via protein-protein interaction is challenging, and to date, no drug that specifically inhibits MYC has been developed. An intriguing possibility is that MYC-driven tumor progression may be blocked by inhibition of CSN5, a far more tractable drug target. The degree, duration, and cell specificity required for CSN5 blockade to attenuate cancer growth should be addressed in future studies.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Robert Weinberg, Paul Khavari, Xin Chen, Dean Felsher, Jason Shohet, Suwon Kim, Yosef Refaeli, Alex Swarbrick, Alana Welm, and Garry Nolan for reagents and Anthony Oro for comments on the manuscript.
| Footnotes |
|---|
5 http://www.ifi.uio.no/forskning/grupper/bioinf/Papers/CGH/ ![]()
6 Gene Expression Omnibus series accession number GSE9206, http://www.ncbi.nlm.nih.gov/geo/. ![]()
Received 8/ 8/07. Revised 10/ 1/07. Accepted 10/17/07.
| References |
|---|
|
|
|---|
and regulates its stability. J Biol Chem 2002;277:9–12.
regulation by CSN5. Genes Dev 2004;18:739–44.
B by deubiquitinylation of I
B
. EMBO J 2007;26:1532–41.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |