| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Cell, Tumor, and Stem Cell Biology |
1 Graduate Program in Genetics, Stony Brook University, Stony Brook, New York; 2 Watson School of Biological Sciences, 3 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; and 4 Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, Missouri
Requests for reprints: Senthil K. Muthuswamy, One Bungtown Road, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724. Phone: 516-367-6975; Fax: 516-367-8461; E-mail: muthuswa{at}cshl.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Par6 is a scaffolding molecule that is involved in multiple protein-protein interactions (10, 11). The most prominent interactions are those made with the members of the Par polarity complex, which consists of Par3, an additional scaffolding molecule, atypical protein kinase (aPKC), and the GTP binding proteins Cdc42/Rac (12–15). These interactions are required for Par6 regulation of cell biological processes. For instance, Par6 regulates aPKC-induced phosphorylation of Lgl (16), Par1 (17), and Numb proteins (18) during establishment of apical-basal polarity in epithelial cells. Likewise, Par6-associated aPKC regulates glycogen synthase kinase 3β (GSK3β) activity to induce polarized migration of astrocytes (19) and promote cell death during three-dimensional epithelial morphogenesis (6). Thus, the Par6 complex can serve as a signaling node that regulates diverse biological processes by controlling activation of downstream pathways.
In addition to its role during normal cell biology, Par6 also regulates initiation and progression of cell transformation. For example, Par6 cooperates with Rac1/Cdc42 to transform fibroblasts (12). We recently found that Par6 interacts with the oncogene receptor tyrosine kinase ErbB2, and this interaction is required for ErbB2-induced disruption of cell polarity and inhibition of cell death in three-dimensional mammary epithelial structures (20). Par6 also cooperates with transforming growth factor β (TGFβ) receptor to promote TGFβ-induced epithelial-to-mesenchymal transition (21). Interestingly, among the three isoforms of Par6 (gene name Pard6), Pard6a, Pard6b, and Pard6g, the Pard6b isoform is located in a region of the genome that is frequently amplified and overexpressed in breast cancer (22–25). It is likely that Par6 not only cooperates with regulators of cell transformation but may also directly regulate cell transformation processes.
Here, we show that expression of Par6 induces epidermal growth factor (EGF)–independent proliferation of normal mammary epithelial cells by promoting activation of mitogen-activated protein kinase (MAPK) signaling. This function of Par6 was dependent on its ability to interact with aPKC/Cdc42, demonstrating that Par6 regulates cell proliferation pathways, in addition to its previously shown role as a regulator of cell polarity and cell migration. Furthermore, we show that Par6 is overexpressed both in human precancerous breast lesions and in estrogen receptor (ER)–positive breast cancers, suggesting that Par6 pathways are likely to play critical roles during initiation and progression of breast cancer. Thus, the polarity protein Par6 promotes transformation of epithelial cells not only by regulating cell polarity pathways but also by inducing cell proliferation.
| Materials and Methods |
|---|
|
|
|---|
Cell growth and S-phase assays. MCF-10A (Vector, Par6
, K19A,
Pro136, M235W, and Par6β) cells were grown to confluency under normal growth conditions and placed in assay medium (DMEM/F12 supplemented with 2% horse serum, 10 µg/mL insulin, 500 ng/mL hydrocortisone, and 100 ng/mL cholera toxin). Cells were then trypsinized, and 5 x 104 (growth curve) or 2.5 x 105 (S-phase) cells were plated in assay medium. For growth curve assays, cells were trypsinized and counted by hemacytometer on days 1, 3, 5, 7, 9, and 11. For S-phase assay, 30% of the assay media were changed on day 1, and cells were imaged by phase microscopy before harvesting on day 3. Cells were collected for flow cytometry by trypsinization and subsequent ethanol (70%) fixation. Cells were rehydrated in PBS with 1% calf serum and stained with 20 mg/mL propidium iodide (Sigma) containing 100 µg/mL RnaseA. Samples were analyzed using an LSRII flow cytometry (Becton Dickinson); at least 10,000 cells per sample were collected. Data from three independent experiments were analyzed using ModFit software (Verity). Comma-1D cells (Vector, Par6
) were grown to confluency under normal growth conditions and then placed in assay medium (DMEM/F12 supplemented with 0.5% FBS and 5 µg/mL insulin). 1 x 105 cells were plated, and cells numbers were counted on day 3 using a hemacytometer.
Three-dimensional morphogenesis assay. MCF-10A stable cell lines (Vector, Par6
, K19A, and Par6β) were trypsinized, and 4,000 single cells per well in an eight-well chamber slide (BD Biosciences) were coated with Matrigel. Cells were grown in assay medium with various amount of EGF (5, 0.5, 0.1, and 0 ng/mL). Medium was changed, and acini were imaged every 4 d. Day 12 acini structures were analyzed using AxioVison 4.5 (Zeiss). The acini size distribution of
600 acini from three independent experiments was represented in a box plot. Each box represents 50% of the data within the interquartile range. The blue line represents the median value, the spread represents 1.5 times the interquartile range, and outliers are shown as circles. Statistical analyses were performed using GraphPad Prism software and Mann-Whitney test. HC11 stable cell lines (Vector, Par6
) were grown on Matrigel with 0.5 ng/mL EGF, and day 12 structures were analyzed as done for MCF-10A cells.
Immunofluorescence. All immunofluorescence procedures were performed as previously described (26). Microscopy was performed on Zeiss Axiovert 200M using AxioVison 4.5 and ApoTome imaging system (Zeiss).
Biochemistry and immunoprecipitation. MCF-10A cells (Vector, Par6
, K19A,
Pro136, M235W, and Par6β) were plated 2 x 106 in growth media, and cells were stimulated on day 5 with 2 µg/mL EGF. Cells were lysed in TNE buffer and immunoprecipitated with Flag or Par6 antibodies as described previously (20).
DNA constructs. Carboxy or amino-terminal Flagepitope tag mouse par6
was generated by PCR amplification of mPar6
from pFlag-CMV-mpar6
(14) and cloned into MSCV-PURO-IRES-GFP (kindly provided by S. Lowe, Cold Spring Harbor Laboratory). Point mutations of mPar6
were generated using site-directed mutagenesis. Amino-terminal Flag epitope-tag human Par6β was generated by PCR amplification from pBluescriptR-hPar6β (American Type Culture Collection) and cloned into MSCV-PURO-IRES-GFP. Two PCK
short hairpin vectors were obtained from Open Biosystems and subcloned into MSCV-LTR-PURO-IRES-GFP (30): targeting sequence for PKC
1 CACAGACAGTAA TTCCATATTAG and PKC
2 GATTATCTCTTCCAAGTTATTAG. Cdc42 short-hairpin vector number 3 was obtained from Open Biosystems and subcloned into MSCV-LTR-HYGRO-IRES-GFP (30). Cdc42 short-hairpin vector number 5 was generated by PCR and subcloned into MSCV-LTR-HYGRO-IRES-GFP: targeting sequence for Cdc42-3 CGGCCTAAAGAATGTATTTGAT and Cdc42-5 CAAGAATGTATTTGACGAAGCA.
Quantitative PCR. Twenty-five breast tumor samples were obtained from the Wigler laboratory (Cold Spring Harbor Laboratory). RNA was isolated using a Versagene RNA tissue kit (Gentra Systems). Normal breast tissue RNA was a gift from David Mu (Cold Spring Harbor Laboratory). Breast cancer cell line RNA was a gift from Adrian Krainer (Cold Spring Harbor Laboratory). MCF-10A control and Par6β-overexpressing RNA were obtained from trizol lysis (Invitrogen) according to the manufacturer's protocol. cDNA was generated using a Taqman reverse transcriptase kit (Roche). Quantitative real-time PCR was performed using SYBR green master mix (Applied Biosystems). The following primer sequences were used for Par6β, 5'-GTGAAGAGCAAGTTTGGAGC-3' and 5'-GATGTCTGATAGCCTACCA-3' and GAPHDH, 5'-CGACAGTCAGCCGCATCTT-3' and 5'-CGTTGACTCCGA CCTTCA-3'. Samples were run on a Peltier thermalcycler (PTC-200) from MJ Research, and data were collected using an Opticon monitor chromo4 continuous fluorescence detector. Cycles were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and compared with MCF-10A or normal breast tissue Par6βlevels.
Antibodies. Antibodies used in this study were against Ki67 (Zymed); PKC
, GM130, Ccdc42, ERK2 (BD Biosciences); hPar6
antibody (previously described; ref. 20); mPar3 (Upstate Biotechnology); PKC
(Santa Cruz Biotechnology); cleaved caspase-3, p-ERM, p-AKT (Cell Signaling Technology); Flag M2, β-actin (Sigma); laminin (Chemicon); p-ERK1 and p-ERK2, p-PKC
, Alexa-Fluor–conjugated secondary antibodies (Invitrogen).
Analysis of human breast cancers. Gene expression was performed on 112 breast tumors samples, and data were generously provided by Therese Sorlei and colleagues. The expression values are median-polished log ratios of expression in tumor cells to that in a reference cell mixture. A Kolmogorov-Smirnov null hypothesis test was used to calculate the P value.
| Results |
|---|
|
|
|---|
) and Pard6b (protein called Par6β) in an EGF-dependent, nontransformed human mammary epithelial cell line, MCF-10A. When plated on Matrigel in the presence of EGF, MCF-10A cells form three-dimensional acini-like structures comprised of a single layer of polarized, proliferation-arrested epithelial cells surrounding a hollow central lumen (31). Overexpression of either Par6 isoform did not affect the ability of MCF-10A cells to form acini with hollow lumens (Fig. 1A
). In addition, these acini had no detectable loss of apical-basal polarity as determined by using the apical polarity marker GM130, a basal polarity marker Laminin V (Fig. 1B and Supplementary Fig. S1), and a basolateral marker E-cadherin (data not shown). Thus, overexpression of Par6 did not affect polarization and morphogenesis of MCF-10A cells on Matrigel.
|
and Par6β overexpressing cells formed acini that were significantly larger than those formed by control cells, irrespective of the dose of EGF (Fig. 1C and Supplementary Fig. S2B). To determine if the increase in size was due to an increase in cell number or cell size, we counted the number of cells per structure. Acini derived from Par6-overexpressing cells had significantly more cells than those derived from control cells (Supplementary Fig. S3). To determine if the increase in cell number is due to changes in cell proliferation rates, we monitored the presence of the proliferation marker Ki-67 during three-dimensional morphogenesis. Consistent with our previous results (31), acini derived from control cells had low proliferation rates on day 12 (Fig. 1D). However, acini derived from Par6-expressing cells had higher proliferation rates until day 20 compared with acini derived from control cells (Supplementary Fig. S4A). Furthermore, we did not observe any evidence for inhibition of cell death pathways in acini derived from Par6-overexpressing cells (Supplementary Fig. S4B and C). Thus, Par6 overexpression induces development of hyperplastic acini by inhibiting proliferation arrest during three-dimensional morphogenesis without disrupting polarity.
The ability of Par6 to promote proliferation was observed in multiple independent populations of MCF-10A cells and in a mouse mammary epithelial cell line, demonstrating that there was no clonal or cell line bias to the phenotype (Supplementary Fig. S5).
Par6-induced cell proliferation requires interaction with aPKC and Cdc42. To gain insight into the mechanisms by which Par6 induces cell proliferation, we generated Par6 mutants that are defective in binding to members of the Par6 complex, such as Par3, Cdc42, Lgl, and aPKC. We generated a lysine-to-alanine mutation in the PB1 (Phox/Bem1p) domain (K19A) to abolish binding to aPKC, deleted Proline 136 in the semi-CRIB binding domain (
Pro136) to disrupt binding to Cdc42, and substituted a methionine with a tryptophan in the PDZ domain (M235W) to disrupt binding to Lgl (refs. 14, 32–35; Fig. 2A
). Each mutant was expressed in MCF-10A cells, and the ability of the mutants to interact with components of the Par complex was determined by coimmunoprecipitation analysis (Fig. 2B–D). As expected, K19A failed to associate with aPKC and retained its ability to associate with Cdc42 (Fig. 2B). In addition, we found that this mutant also lost its ability to interact with Par3 and Lgl (Fig. 2B). The
Pro136 mutant was defective in its ability to bind Cdc42 but associated with Par3, aPKC, and Lgl. The M235W mutant did not bind Cdc42, Lgl and was defective in binding Par3 but still associated with aPKC (Fig. 2B).
|
Pro136 mutant showed that interaction with Cdc42 was necessary whereas aPKC, Par3, and Lgl were not sufficient to promote proliferation. The inability of Par6M235W to promote proliferation confirmed our conclusion that interaction with Cdc42 was necessary and that an interaction with aPKC was not sufficient to induce EGF-independent proliferation. Because the binding of Cdc42 to Par6 induces aPKC kinase activity in the Par6 complex (3, 7), it is likely that Par6-aPKC-Cdc42 forms a core complex to promote EGF-independent cell proliferation of mammary epithelial cells.
Par6-induced cell proliferation requires both aPKC and Cdc42. To determine if aPKC and Cdc42 play a role during Par6-induced cell proliferation, we knocked down expression of aPKC and Cdc42 in both control and Par6-expressing cell lines using two independent short hairpin RNAs for each aPKC and Cdc42 (Fig. 3A
). The aPKC RNA interference (RNAi) vectors significantly down-regulated the expression level of PKC
and had a modest effect on the levels of PKC
(Fig. 3A). Decreased expression of PKC
significantly impaired the ability of Par6-overexpressing cells to proliferate in the absence of EGF while having no significant effect on the basal proliferation observed in vector control cells (Fig. 3B).
|
Par6 overexpression activates MAPK signaling. To understand how Par6 expression promotes cell proliferation, we tested if Par6 induced autocrine production of growth factors or juxtacrine activation of cell-cell signaling pathways. Conditioned media from Par6-expressing cells failed to promote proliferation of vector control MCF-10A cells (data not shown). In addition, coculturing experiments showed that Par6-expressing cells did not induce EGF-independent proliferation of control cells (data not shown). These observations suggest that Par6 promotes proliferation in a cell autonomous manner.
We therefore investigated cell autonomous mechanisms by which Par6 promotes cell proliferation. Activation of the EGF receptor (EGFR) pathway is an attractive possibility, because our data showed that Par6 induces EGF-independent proliferation of MCF-10A cells (Fig. 2D and Supplementary Figs. S2C and S5A). However, we did not observe EGF stimulation–independent phosphorylation of EGFR in Par6-overexpressing cells (data not shown), suggesting that Par6 overexpression does not directly induce EGFR phosphorylation. To determine if Par6 activates pathways downstream of EGFR, we investigated activation of PLC
, phosphatidylinositol 3-kinase (PI3K), Ras/MAPK, and c-Jun NH2 kinase (JNK), both in the presence and in the absence of EGF stimulation. Par6 overexpression had no effect on activation of PLC
, PI3K, or JNK pathways, either in the presence or in the absence of EGF (Fig. 4A
and data not shown). However, Par6-overexpressing cells had a significant increase in extracellular signal-regulated kinase (ERK) phosphorylation in the absence of EGF stimulation. In the presence of EGF stimulation, ERK phosphorylation returned to basal levels by 30 minutes in vector control cells, whereas in Par6-overexpressing cells, it was prolonged for 60 (Fig. 4B) and 120 minutes (Supplementary Fig. S2D). In contrast to Par6, the Par6 mutants neither induced phosphorylation of ERK in the absence of EGF nor promoted sustained ERK phosphorylation in the presence of EGF (Fig. 4B and Supplementary Fig. S6).
|
Pard6b is overexpressed in ER-positive human breast tumors. Next, we investigated if the genes encoding for the Par6 family of proteins (Pard6) are targeted for overexpression in breast cancer. Interestingly, Pard6b (Chr. 20q13.13), but not Pard6a (Chr. 16q22.1) or Pard6g (Chr. 18q23), is located in a region of the genome that is frequently amplified in breast cancer (22–25), and this amplification correlated with increased Pard6b gene expression (23, 24). To directly test if Pard6b is overexpressed in primary human breast cancers, we performed quantitative PCR analysis from 25 primary breast tumors, 2 normal breast tissue samples, 6 breast cancer cell lines, and MCF-10A cells. We found that 6 of 25 primary tumors and 2 of 6 breast cancer cells express mRNA at least 2-fold more than the levels observed in their respective controls (Fig. 5A and B ). Thus, among the Pard6 family members, Pard6b is genomically amplified and transcriptionally up-regulated in breast cancer.
|
Almost all precancerous breast lesions are ER-positive (40). Furthermore, we recently showed that hyperplastic enlarged lobular units (HELU), the earliest histologically identifiable precursor of breast cancer, show high proliferation rates and an increased expression of members of both EGF and ER signaling modules (40, 41). Interestingly, like the three-dimensional acini derived from Par6 overexpressing MCF-10A cells, HELUs are hyperplastic structures wherein the acini are enlarged in size due to increase in cell number with no apparent loss of acinar architecture. Given the architectural similarity, we tested if Par6 was overexpressed in HELUs. RNA isolated from microdissected HELU and adjacent TDLU were analyzed by microarray (41). Pard6b, but not Pard6a or Pard6g, was overexpressed by 2.5-fold (P = 0.002) in HELUs compared with adjacent TDLUs. The gene encoding for PKC
(PRKCZ), a component of Par6 complex, was also up-regulated by 1.46-fold (P = 0.029) compared with TDLUs (ref. 41; Fig. 5D). Thus, our results show that overexpression of Par6/aPKC is observed early in precancerous lesions and retained during development of ER-positive cancers.
It is possible that the Par6/aPKC/Cdc42 complex is a novel target for therapeutic intervention for both early and late stage of breast cancers. To test this possibility, we down-regulated expression of aPKC in a breast cancer–derived cell line, MCF7. Down-regulation of PKC
decreased cell proliferation (Fig. 6A and B
), suggesting that inhibiting aPKC is likely to have important therapeutic relevance. Taken together, our results show that Par6/Cdc42/aPKC is a regulator of cell proliferation and suggests that the Par6 complex is a novel therapeutic target for breast cancer.
|
| Discussion |
|---|
|
|
|---|
Our results show that overexpression of Par6
and Par6β in nontransformed mammary epithelial cells does not affect establishment of apical-basal polarity during acinar morphogenesis. Whereas several studies have reported that altered expression of both Par6
and Par6β delays establishment of apical polarity (2, 3), they also find that the cells recover from the effects of Par6 overexpression and eventually develop cell polarity. This suggests that compensatory mechanisms act redundantly to ensure apical polarity formation in the presence of altered Par6 expression. Because MCF-10A acinar morphogenesis takes several days, it is likely that Par6-overexpressing cells use these compensatory mechanisms to establish proper apical polarity. We found that ectopic expression of Par6 promotes proliferation of multiple mammary epithelial cell lines, demonstrating that, in addition to its known role as a polarity regulator, Par6 can also induce cell proliferation.
Both aPKC and Cdc42 are required for Par6 to stimulate cell proliferation. This is consistent with the established role of aPKC and Cdc42 in Par6-mediated regulation of tight junction biogenesis, polarized cell migration, and cell death (3, 6, 19, 42). Although previous studies have shown that Par6-induced modulation of GSK3β activity is required for directed cell migration and apoptosis, GSK3β is unlikely to play a role in Par6-induced cell proliferation, because we did not see any differential phosphorylation of GSK3β in Par6-overexpressing cells (data not shown). Instead, we found that Par6 overexpression induces ERK phosphorylation in the absence of EGF, identifying MAPK pathway as an effector of the Par6-aPKC-Cdc42 complex. MAPK signaling can be activated by ligand-independent phosphorylation of EGFR (43). However, we did not observe phosphorylation of EGFR in the absence of EGF, ruling out a role for EGFR phosphorylation as a mechanism to activate MAPK pathway in Par6-overexpressing cells. Previous studies have shown that PKC is not only sufficient but is also required for activation of ERK in a MEK-dependent manner in response to serum stimulation (44–47). Similarly, we find that Par6 uses aPKC to activate ERK in a MEK-dependent manner. The precise mechanism by which aPKC activates MEK remains to be understood. Thus, in addition to its known effectors that regulate cell polarity, the Par6-aPKC-Cdc42 complex also regulates molecules that induce cell proliferation.
Our results show that Par6β is overexpressed both in HELUs and ER-positive advanced carcinomas. HELUs are characterized by high rates of cell proliferation, ER positivity, and increased expression of EGF family of growth factors. It is possible that HELUs arise from cooperation between overexpressed Par6 and EGF ligands, similar to how Par6 overexpression induced hyperplastic acini in our MCF-10A three-dimensional cultures. Considering that Par6 overexpression promoted hyperplastic acini in MCF-10A three-dimensional culture in cooperation with EGF, it is possible that these two factors could cooperate during development of premalignant lesions in the breast. Our data combined with other studies that show that Par6 is amplified genomically and overexpressed in ER-positive advanced carcinoma suggest that there is a genetic advantage associated with increased Par6 expression during breast cancer progression.
Par6 is also known to cooperate with oncogenes associated with breast cancer progression. For example, Par6 plays a critical role during ErbB2-induced transformation of organized epithelia (20) and ErbB2 amplification is associated with the premalignant breast disease DCIS (48). We did not observe either a positive or negative correlation between Par6 overexpression and ErbB2 status. Therefore, ErbB2 requires expression of Par6, but not overexpression. In addition, Par6 is required for TGFβ-induced epithelial-to-mesenchymal transition, a cellular process that is associated with invasion. The ability of Par6 to interact with oncogenes in distinct cellular processes suggests that Par6 has multiple functions. The results presented in this manuscript, taken together with those above, suggest that the polarity signaling pathways regulated by Par6 plays a cooperative role during the initiation and progression to breast cancer. Thus, a further understanding of the alterations in the Par6 signaling pathways could identify both novel drug targets and predictive biomarkers for breast cancer progression.
| Disclosure of Potential Conflicts of Interest |
|---|
|
|
|---|
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Tony Pawson for Par6a cDNA, Therese Sorlei and Anne Lisa Bornestein for sharing the microarray data, and the members of Muthuswamy laboratory, Daniel Nolan, and Catherine Cormier for helpful suggestions.
| Footnotes |
|---|
Received 12/11/07. Revised 6/25/08. Accepted 8/ 5/08.
| References |
|---|
|
|
|---|
. Cell 2001;106:489–98.[CrossRef][Medline]
signaling controls glial-guided neuronal migration. Nat Neurosci 2004;7:1195–203.[CrossRef][Medline]
signaling and cell transformation. Curr Biol 2000;10:697–707.[CrossRef][Medline]
isoform is critical for mitogenic signal transduction. Cell 1993;74:555–63.[CrossRef][Medline]
. EMBO J 1995;14:6157–63.[Medline]
is accompanied by the loss of constitutive nuclear mitogen-activated protein kinase/extracellular signal-regulated kinase activity. J Biol Chem 1997;272:11557–65.This article has been cited by other articles:
![]() |
A. M. Viloria-Petit, L. David, J. Y. Jia, T. Erdemir, A. L. Bane, D. Pinnaduwage, L. Roncari, M. Narimatsu, R. Bose, J. Moffat, et al. A role for the TGF{beta}-Par6 polarity pathway in breast cancer progression PNAS, August 18, 2009; 106(33): 14028 - 14033. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |