
Cancer Research 68, 8231, October 15, 2008. doi: 10.1158/0008-5472.CAN-08-1483
© 2008 American Association for Cancer Research
Cell, Tumor, and Stem Cell Biology |
Netrin-1 Induces Apoptosis in Human Cervical Tumor Cells via the TAp73
Tumor Suppressor
Jean-Pierre Roperch1,
Karima El Ouadrani1,
Ann Hendrix2,3,
Shahin Emami1,
Olivier De Wever1,2,
Gerry Melino4 and
Christian Gespach1
1 Institut National de la Sante et de la Recherche Medicale U673 Molecular and Clinical Oncology of Solid Tumors and Institut National de la Sante et de la Recherche Medicale U893; Université Pierre et Marie Curie-Paris 6, Faculté de Médecine, Hôpital Saint-Antoine, Paris, France; 2 Laboratory of Experimental Cancerology and 3 Department of Medical Oncology, Gent University Hospital, Gent, Belgium; and 4 Medical Research Council, Toxicology Unit, Leicester University, Leicester, United Kingdom
Requests for reprints: Christian Gespach, Institut National de la Sante et de la Recherche Medicale, U673-U893, Hôpital Saint-Antoine, 75571 Paris Cedex 12, France. Phone: 33-1-43453477; Fax: 33-1-49384694; E-mail: christian.gespach{at}inserm.fr.
 |
Abstract
|
|---|
Netrins and their receptors deleted in colon cancer (DCC), neogenin, UNC5, and integrins are involved in axon guidance, epithelial morphogenesis, vascular pattering, cancer cell survival, invasion, tumor angiogenesis, and metastasis. Here, we considered the possible contribution of the p53-related apoptosis mediators p63 and p73 in the mechanisms underlying the antagonism between netrin-1 and DCC at the cell death control. We have showed that ectopic expression and external addition of netrin-1 in HeLa and HEK-293 cells with inactive p53 lead to impaired cell viability and induction of apoptosis. These responses were associated with up-regulation of the proapoptotic protein TAp73
, decreased Bcl-2/Bax ratio, and caspase-3 cleavage, with no change in protein levels of the antiapoptotic NH2-terminal–truncated
Np73
isoform, p73 adapter Yap-1 and p73 E3 ubiquitin ligase Itch, and p63, as well as the transcripts encoding p63, TAp73
, and
Np73
. However, the proteasome inhibitor MG132 potentiated, while DCC counteracted, netrin-1–induced TAp73
. Consistently, netrin-1 expression correlated with stabilization of the TAp73
protein and lower levels of TAp73
ubiquitination that was conversely enhanced by DCC, in a netrin-dependent manner. Our data indicate that netrin-1 selectively up-regulates TAp73
by preventing its ubiquitination and degradation. Targeted repression of p73
by shRNA reversed TAp73
and the apoptosis induced by netrin-1, and exacerbated the growth of HeLa tumor xenografts. Apoptosis induced by cisplatin was markedly enhanced in netrin-1 or DCC-expressing cells. Collectively, our data reveal that the transcriptionally active TAp73
tumor suppressor is implicated in the apoptosis induced by netrin-1 in a p53-independent and DCC/ubiquitin-proteasome dependent manner. [Cancer Res 2008;68(20):8231–9]
 |
Introduction
|
|---|
Alterations in the molecular integrity and expression of deleted in colorectal Cancer (DCC) and netrin-1 have been reported in several human cancers. In a large fraction of colorectal cancers, loss of heterozygosity (LOH) of chromosome 18q, including the DCC locus, has been described (1). Similarly, homozygous deletions and point mutations have been detected in colorectal, testicular, and pancreatic cancers. Netrin receptors DCC and UNC5 family are down-regulated in over half of all colorectal cancers. In addition, epigenetic inactivation of DCC and UNC5C genes has been described after promoter hypermethylation and gene silencing, suggesting that they function as putative tumor suppressor genes in many tumor types, including human solid tumors and acute lymphoblastic leukemia (2–6). These genetic, epigenetic, and molecular alterations are also found in brain, breast, urogenital, and digestive cancers (7). The tumor suppressive functions of DCC and UNC5H are linked to their ability to induce apoptosis when they are not engaged with their ligands netrins (7, 8). The three secreted netrins-1, netrin-3, and netrin-4 in mammals belong to a conserved family of guidance clues related to the matricellular protein laminin. The netrin signaling pathways are also initiated through the transmembrane receptors neogenin and integrins, and multiple downstream cascades using focal adhesion kinase (FAK), src and Fyn tyrosine kinases, and the Rho-GTPases. Thus, netrins signal via the simultaneous activation of several receptor subtypes and signal transduction pathways involved in critical cellular and molecular mechanisms linked to tumor progression, including cancer cell survival, tumor angiogenesis, invasion, and metastasis (9–14).
Despite intensive efforts to delineate the intracellular mechanisms of netrin signaling in normal and transformed cells, little is known on the pathways underlying the antagonism between DCC and netrin in cancer cell survival. Apoptosis induced by DCC is dependent on caspase activation but independent of the intrinsic mitochondrial and the extrinsic death receptor–mediated pathways (7, 14). However, the possible implication of the p53 family members in the netrin-1 and DCC pathways on these mechanisms has not been explored, until now. The p53 family members include the p63 and 73 tumor suppressor proteins involved in cell cycle regulation, DNA repair, apoptosis, and transcription of cell proliferation and survival genes (15). In addition, structural homologies, as well as molecular interactions and permissive or antagonistic regulations between these wild-type (wt) and mutated proteins are detected in several models (16–18). Similarly to p53, p73 can promote growth arrest or apoptosis when overexpressed in certain p53-null tumor cells. All p53 family members contain the NH2-terminal transactivation (TA) domain for recruitment of core transcriptional factors, a DNA-binding domain for recognition of promoter sequences, and an oligomerization domain for tetramerization. Similarly to the TP63 gene, the TP73 encodes several NH2- and COOH-terminal isoforms with opposing functions and is rarely mutated in human tumors (15). These additional motifs found in both p63 and 73, but not in p53, are created by a combination of two alternative promoters, leading to the synthesis of NH2-terminal isoforms (TAp73 and
Np73), and alternative splicing variants at the COOH-terminal exons 10 to 14. TAp73
is transactivation active and is proapoptotic, whereas
Np73
is not. The COOH-terminal isoforms TAp73
are different according to the sterile
motif (SAM) domain and the transcription inhibitory domain (17, 19). The NH2 terminally truncated
Np73
proteins interfere with the transactivation function of TAp73
and p53 in a dominant-negative manner, inhibiting apoptosis (20, 21). Moreover,
Np73
is up-regulated in several cancers and is therefore associated with advanced pathologic states and poor prognosis features in human colon and breast cancers and in patients suffering from neuroblastoma (19, 22). Because the TP53 tumor suppressor gene is frequently lost and invalidated by LOH and mutational alterations in human solid tumors, we decided to focus on the two p53 homologues p73 and p63, rarely mutated in cancer, investigating their potential role in the netrin-1 and DCC antagonism on cell viability and apoptosis. For this purpose, we examined the relationships between netrin-1, cancer cell survival, and the p73 and p63 status in the p53-deficient HeLa and HEK-293 cell lines. Indeed, viral oncoproteins such adenovirus 5 E1B in HEK-293 cells, human papillomavirus E6 in HeLa cells, as well as SV40 large T, inactivate p53 by protein-protein interaction but do not seem to interact with p73 (23).
 |
Materials and Methods
|
|---|
Cell culture conditions, expression vectors, and transfections. Human cervical and kidney cell lines HeLa and HEK-293 cells were cultured at 37°C in DMEM without antibiotics (Invitrogen) supplemented with 10% FCS (PAA Laboratories). Ectopic expression of netrin-1 and DCC was achieved by transient transfection of HeLa and HEK-293 cells (2.5 x 105) using either the pcDNA3.1-Netrin-1 vector encoding myc-tagged chicken netrin, or the pCMV-DCC vector encoding the full-length human DCC, and their combination, as described (14). The pcDNA3 vector encoding E2F1 (24) was a generous gift from Dr. C. Prives, Columbia University, New York, NY. Empty pcDNA3.1 vector was used to keep the amount of DNA constant. Cells were transiently transfected for 6 h at 70% to 90% confluency, using the plasmid DNA (up to 2 µg) mixed with the Lipofectamine 2000 reagent (Invitrogen) at the DNA (µg)/lipid (µL) ratio of 1:2.5. Transfected cells were then cultured in fresh medium for up to 24 to 48 h and harvested for transgene expression and other assays. Silencing of p73 was performed with SureSilencing p73-shRNA plasmids (Super Array-Bioscience Corporation) containing 4 pooled shRNA sequences to ensure an effective depletion of the six p73 isoforms in HeLa and HEK-293 cells. Each vector expresses a short hairpin RNA (shRNA), under the control of the U1 promoter. The shRNA-p73 sequences are as follows: (+1474) 5'-TGTCCAAACTGCATCGAGTAT-3'; (+655) 5'-GGCAATAATCTCTCGCAGTAT-3'; (+750) 5'-CACCATCCTGTACAACTTCAT-3'; (+178) 5'-TCTGTCATGGCCCAGTTCAAT-3', and GGAATCTCATTCGATGCATAC for the scrambled control sequence (sh-CON). For stable transfection, HeLa cells were selected for 2 wk in 1 mg/mL G418-containing medium. Two control clones (sh-CON, clones 1 and 3) and two clones of p73-silenced HeLa cells (shRNA-p73, clones 1 and 2) were then further selected and characterized.
Semiquantitative and real-time quantitative reverse transcription PCR analysis. Total RNA was extracted from HeLa and HEK293 cells using the RNAeasy Mini kit (Qiagen). For semiquantitative and qRT-PCR, total RNA (2–2.5 µg) was reverse transcribed using the Superscript III First-Strand Synthesis kit (Invitrogen). The relative levels of the β-actin and p73
isoforms transcripts were evaluated using a denaturation step at 95°C for 5 min, followed by 30 cycles at 95°C for 30 s. Primers were as follows: forward 5'-ACCAGACAGCACCTACTTCG-3', reverse 5'-TCGAAGGTGGAGCTGGGTTG-3' (TAp73
, amplicon: 252 bp); forward 5'-AAGCGAAAATGCCAACAAAC-3', reverse 5'-CACCGACGTACAGCATGGTA-3' (
N-p73
, 213 bp); forward 5'-AACGTCACGCTCACACTGTC-3', reverse 5'-GAGTCGTCCTCGTTCTCGTC-3' (Netrin-1, 404 bp); forward 5'-AGAAAATCTGGCACCACACC-3', reverse 5'-CCATCTCTTGCTCGAAGTCC-3' (β-actin, 434 bp). The cDNAs used in quantitative PCR were synthesized from 2 µg total RNA extracted from 2 independent experiments using the netrin-1, DCC, and E2F1 expression vectors. The real-time PCR reactions typically contained 1 µL of each gene-specific primer (final concentration, 0.5 µmol/L), 10 mL SYBR Green PCR Master Mix (2x; from Roche Applied Biosystems), and 2 mL of the diluted cDNAs (1:10) in a total volume of 20 mL. Primers for qRT-PCR analysis were as follows: TAp73
, 106 bp: forward 5' CCTCTGGAGCTCTCTGGAAC 3', reverse 5' GAAGACGTCCATGCTGGAAT 3';
Np73
, bp107: forward 5' CAGCCAGTTGACAGAACTAAGG 3', reverse 5' AGAGGCTCCGCAGCTAGTGA 3'; and Actin, 90 bp: forward 5' GGATGCAGAAGGAGATCACTG 3', reverse 5' CGATCCACACGGAGTACTTG 3'. The quantitative PCR reactions were performed in duplicate using a LightCycler 480 Real-Time PCR Systems (Roche Applied Science). The thermal cycling conditions included an initial denaturation step at 95°C for 10 min, 40 cycles at 95°C for 15 s, and 63°C for 1 min.
Western blot analysis. Immunoblot analysis was performed essentially as described (14). The blots were probed for 1 h at room temperature with one of the after primary monoclonal (mAb) or polyclonal (pAb) antibodies: the pAb directed against the SAM domain SAM of human p73
(1:2,000 dilution) and p63
(1:1,000) as described (25); the pAb directed against phosphorylated p73
at Y-99 (1:1,000; Genescript Corporation); the pAbs against β-actin (1:1,000), human p63
(1:500), DCC (1:500), Yap-1 (1:250), and Bax (1:250) are from Santa Cruz Biotechnology; the mAbs against cleaved caspase-3 (1:500) and chicken netrin-1 (1:250) are from Cell Signaling and R&D Systems, respectively; the Itch pAb (1:500) and the mAbs against Bcl-2 (1:500) were from BD Transduction Laboratories. Membranes were reprobed for 1 h with the appropriate peroxidase-conjugated secondary antibodies in blocking buffer (1:10,000; Santa Cruz Biotechnology). Signals were visualized with the enhanced chemiluminescence Western blotting detection system (GE Healthcare), and quantified by densitometric analysis, using ImageQuant software and digital scanning (Agfa).
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, apoptosis, and fluorescence-activated cell sorting analyses. HeLa and HEK-293 cells (2 x 104 cells per well) transiently transfected for 24 h by the control vector and the netrin-1 and DCC expression vectors were treated for 48 h with either 10 µmol/L cisplatin or 0.6 µmol/L doxorubicin. Then, cultured cells were subjected to the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Sigma). Cell cycle phase distribution and apoptosis in sub-G1 fractions were analyzed by flow cytometry of propidium iodide–labeled DNA content profiles, using a Becton Dickinson FACSCalibur. Labeling DNA breaks by the terminal deoxynucleotidyltransferase-mediated dUTP nick-end labeling (TUNEL) assay was performed using the Apo-BrdUrd kit. All assays were performed in triplicates for each condition. Results are presented as means ± SE. Statistical analysis was performed using the Student's t test.
TAp73
ubiquitination assays and stability. HEK-293 cells were transiently cotransfected with expression vectors encoding TA-p73
(26) and His6-c-Myc–tagged human ubiquitin (27), in the presence of the control, netrin-1, and DCC expression vectors. Transfected cells were cultured for 32 h in standard culture conditions, and then treated for 8 h with the proteasome inhibitor MG132 before harvesting (10 µmol/L; Stressgen). Cell extracts were prepared in NP40 lysis buffer and Myc-ubiquitin–conjugated proteins were separated by overnight incubation at 4°C, using Ni-NTA-agarose beads (Qiagen). The beads were washed thrice with the NP40 lysis buffer, and the nickel-binding proteins were resuspended in 1x Laemmli sample buffer, denatured for 5 min at 95°C, and loaded onto 10% polyacrylamide-SDS gels before being subjected to Western blotting with the p73
anti-SAM domain pAb (25). For the determination of TA-73
protein stability, HEK-293 cells were cotransfected for 24 h with a 1:5 ratio for the TAp73
/pcDNA3 and TAp73
/Netrin-1 plasmids (3 µg total DNA). Cells were then treated with 50 µg/mL cycloheximide (Sigma), and whole cell lysates were processed at the indicated time points for immunoblot analysis. The relative amount of TA-p73
protein was evaluated by densitometry and normalized to β-actin signals.
 |
Results
|
|---|
Netrin-1 affects cell death and survival. To examine the role of netrin-1 on cell viability and cell cycle progression, we transfected p53-deficient HeLa cancer cells with expression vectors encoding either netrin-1, wt-DCC, and their combination. We noted that netrin-1 or DCC expression reduced HeLa cell viability by 30% (Fig. 1A
). This cellular response was attenuated by ectopic expression of both DCC and netrin-1, as expected. Our results suggested that netrin-1 reduces cancer cell survival while counteracting the established proapoptotic functions of the DCC tumor suppressor. To further document this observation, we next examined the role of netrin-1 on cell cycle progression and apoptosis by fluorescence-activated cell sorting (FACS) analysis. Both netrin-1 and DCC induced, respectively, a 2.6- and 2.2-fold increase of the apoptotic cell fraction in cultured HeLa cells (sub-G1 fraction) without any change in the distribution of HeLa cells at the successive transitions of the cell cycle (Fig. 1B). As observed in the MTT assay, simultaneous expression of both netrin-1 and DCC neutralized their respective deleterious functions on HeLa cell apoptosis. We subsequently confirmed these data using the TUNEL assay showing that netrin-1 increased the percentage of apoptotic cells 4-fold, DCC 6-fold, and their combination, only 2-fold (Fig. 1C).

View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1. Impact of Netrin-1 and DCC on cell viability, apoptosis, and the cell cycle. HeLa cells were transiently transfected with expression vectors encoding either Netrin-1, DCC, and their combination (Net + DCC), and compared with control vector–transfected cells, as described in Materials and Methods. A, cell viability was evaluated by the MTT assay. Colorimetric evaluation was performed using a spectrophotometer at 570 nm. Data are expressed as the percentage of the control values measured in sham-transfected cells (control vector). B, distribution of HeLa cells along the cell cycle phases was quantified by FACS analysis in propidium iodide-stained cells after transient transfection of HeLa cells as indicated above. Data are expressed as the percentage of HeLa cells at the sub-G1 fraction (apoptotic cells, top) and those found at the other phases of the cell cycle (bottom); C, cell apoptosis was determined in the same experimental conditions by the TUNEL assay and FACS analysis to determine the percentage of apoptotic cells at the sub-G1 fraction. Data are means ± SE of at least three separate experiments. Significant differences versus control vector were as follows: *, P < 0.05; **, P < 0.001 in A; *, P < 0.05 in B; *, P < 0.05; **, P < 0.01; ***, P < 0.001 in C; #, P < 0.001 versus DCC vector in C.
|
|
Induction of TAp73
protein by netrin-1 expression. We next evaluated whether the p53-related proteins p73
and p63 were involved in the apoptosis induced by netrin-1 in the p53-deficient cell lines HeLa and HEK-293. First, we investigated the effect of netrin-1 ectopic expression on the accumulation of their transcripts and protein isoforms. As shown in Fig. 2A
, netrin-1 selectively induced a robust accumulation of the TAp73
protein in HeLa cells (73 KD; 2.6 ± 0.06-fold increase; n = 3), without any significant change in the transcript levels of TAp73
and
Np73
(Fig. 2C) by semiquantitative (left) and real-time reverse transcription-PCR (RT-PCR; right). Our data indicate that netrin-1 is acting on TAp73
expression through posttranscriptional mechanisms. Consistently, ectopic netrin-1 failed to up-regulate
Np73
and p63
proteins in HeLa cells (Fig. 2A). In keeping with our data on cell survival and apoptosis in HeLa cells (Fig. 1), netrin-1 down-regulated the anti-apoptotic protein Bcl-2 (5.3-fold) and up-regulated the proapoptotic protein Bax (1.4-fold) in HEK-293 cells (Fig. 2A), resulting in a decreased Bcl-2/Bax ratio, an index of the apoptosis signature. This conclusion was further validated by the detection of the cleaved caspase-3 protein in netrin-1–transfected HEK-293 cells. As shown in Fig. 2B, the induction of the TAp73
protein by netrin-1 was confirmed and extended in the p53-deficient HEK-293 cell line (3 ± 0.7-fold increase; n = 4 experiments).

View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2. Induction of the TAp73 protein levels by Netrin-1 is associated with the divergent regulation of the apoptosis-related proteins Bcl-2 and Bax in p53-deficient cells. Comparative immunoblot analysis of the TAp73 , Np73 , p63 , Bcl2, Bax, and caspase-3 proteins in HeLa cells (A) and HEK-293 cells (B) transiently transfected with control vector and expression vector encoding Netrin-1. Both HeLa and HEK-293 cells were harvested at 48 h posttransfection. Total cell lysates were analyzed by immunoblotting using the corresponding antibodies. Endogenous β-actin protein levels was used as loading control. C, expression levels of the transcripts encoding TAp73 , Np73 , and Netrin-1, versus β-actin by semiquantitative RT-PCR in HeLa cells transiently transfected by the control and netrin vectors (left). Right, quantification of the endogenous levels of the TA- and DN73a transcripts by SYBR-Green qRT-PCR in HeLa cells transiently transfected with control and expression vectors encoding Netrin-1, DCC, and E2F-1 transcription factor as a positive control for P73 gene induction. Results of the real-time PCR are represented as CT values, where CT was defined as the threshold cycle number of PCRs at which amplified product was first detected. Changes in gene expression were calculated using relative quantification as follows: Ct = Cta – Ctb, where Ct is the cycle number at which amplification increases above the background threshold, Ct is the change in Ct between two test samples, a is the target gene, and b is the calibrator gene (β-actin). The amount of gene expression, present at the beginning of the reaction, was then calculated using 2– Ct method. Significantly different at P < 0.01 (*) versus control vector–transfected cells.
|
|
Implication of TAp73
in the apoptosis induced by netrin-1. We sought to determine whether TAp73
expression was essential in the netrin-1 apoptotic function. Expression of the TAp73
isoform was inhibited by transient transfection of HeLa cells by shRNA, and its reduced protein expression was tested by immunoblot analysis. As shown in Fig. 3A
, the p73 shRNA reduced by 29% and 70% endogenous and netrin-1–induced TAp73
levels in HeLa cells, respectively (n = 3 experiments), whereas the control scrambled RNA vector had no interference on the induction of TAp73
by netrin-1 in sh-CON cells (5.5 ± 0.6-fold increase). Results obtained in HeLa cells were confirmed in HEK-293 cells transfected by the netrin-1 vector in the presence and absence of the p73 shRNAs versus the scrambled sequences (data not shown). Most importantly, the p73 shRNAs reversed the induction of the p73
protein by netrin-1 to control levels (scrambled) and was able to reduce by 65% ± 3.3% the netrin-1–dependent apoptosis in HeLa cells (Fig. 3A). Our data imply that netrin-1 mediates apoptosis through induction of the TAp73
proapoptotic form.

View larger version (13K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3. Impact of p73 silencing, DCC, and proteasome inhibition on TAp73 protein levels and apoptosis. A, HeLa cells were transiently transfected with the p73 shRNAs (shRNA-p73) versus scrambled shRNA sequences (sh-CON), in the presence or absence of the Netrin-1 vector. Forty-eight-hour posttransfection cells were harvested and subjected to Western blot analysis and TUNEL assay by flow cytometry. Top, endogenous TAp73 levels were detected by the anti-SAM domain p73 pAb. Netrin-1 and β-actin immunoblots were performed as controls for ectopic Netrin-1 expression and protein loading; bottom, depletion of TAp73 by RNA interference restricts Netrin-1–induced apoptosis. For the apoptosis determination, the corresponding cell pellets were fixed with PBS containing 1% paraformaldehyde and were stained for TUNEL-positive cells by FACS analysis. Columns, mean of three separate experiments; bars, SE. Significant differences at P < 0.05 (*) between scrambled sh-CON sequences ± Netrin-1 and P < 0.01 (**) between shRNA-p73 and sh-CON in Netrin-1–transfected cells; B, HeLa cells were transiently transfected for 24 and 48 h with control empty vector and expression vectors encoding either Netrin-1 or wt-DCC. Cell extracts were prepared for Western blot analysis of DCC, TAp73 , Netrin-1, and β-actin, as described above. C, HeLa cells were transfected for 32 h with the Netrin-1, DCC, and control vectors or their combination. Then, transiently transfected cells were treated for 8 h with the proteasome inhibitor MG132 (10 µmol/L) or the control vehicle DMSO (0.1%). Whole-cell lysates were immunoblotted with the pAb and mAb directed against DCC, the p73 SAM domain, or Netrin-1. β-actin protein immunoblot was shown to demonstrate equal loading of the gels. Data are representative of another experiment.
|
|
Role of the netrin-1 receptor DCC in the induction of TAp73
by netrin-1. We next examined the molecular status of the DCC tumor suppressor gene in HeLa cells. Using combined PCR and sequencing methods to amplify and characterize the molecular integrity of the DCC gene in this model, we detected an internal deletion of six bp within exon 26, leading to the RTV sequence in HeLa cells instead of RSQV in the wt-DCC protein sequence (Supplementary Fig. S1). Such a molecular alteration in the DCC gene has been previously reported in the IMR-32 neuroblastoma cell line (28). Taking into account the DCC molecular status in our model, we next explored the effect of wt-DCC on p73
protein levels after transient transfection of HeLa cells for 24 and 48 hours with the netrin-1 and DCC expression vectors. As shown in Fig. 3B, reconstitution with wt-DCC in HeLa cells failed to elevate endogenous p73
levels but instead decreased by 15% and 32% the p73
levels induced by netrin-1 at the 24- and 48-hour time points. Of note, loss of the DCC signal observed at 48 hours in the presence of netrin-1 is associated with amplification of the TAp73
signal. As expected, simultaneous expression of netrin-1 with wt-DCC decreased and abolished DCC levels in HeLa cells at 24 and 48 hours, respectively, in agreement with previous reports showing that DCC is subjected to ubiquitin-dependent degradation after interaction with its ligand, netrin-1 (29). Consistently, the stability of the ectopic wt-DCC protein was greatly enhanced by MG132 in HeLa cells (Fig. 3C). In contrast, endogenous DCC was not detected in the presence and absence of this proteasome inhibitor, suggesting that the resident DCC protein is either (a) expressed at very low levels, (b) is expressed under a mutated/truncated form, as shown in HeLa cells, or (c) is not expressed at all, due to other mutations or truncations in coding/noncoding regions of the DCC gene. Because introduction of wt-DCC in HeLa and HEK-293 cells induced apoptosis, one can postulate that endogenous DCC is not functioning as a dominant-negative form of the transfected wt-DCC form. It is therefore likely that the endogenous DCC pathway is inactivated in these two models.
Implication of the ubiquitin-proteasome pathway in the induction of p73
by netrin-1. Because p73
stability is regulated by the ubiquitin-proteasome pathway (30), we next examined whether the proteasome inhibitor MG132 affected TAp73
induced by netrin-1 in the presence and absence of wt-DCC. As shown in Fig. 3C, MG132 strongly potentiated TAp73
levels induced by netrin-1 in the presence and absence of the wt-DCC vector. In contrast, wt-DCC was ineffective in the induction of the TAp73
protein in HeLa cells incubated in the presence or absence of the proteasome inhibitor. DCC decreased netrin-1–induced TAp73
levels under both conditions, in spite of the depletion of wt-DCC protein induced by netrin-1. We found that netrin-1 had no effect on the expression levels of the p73 ubiquitin ligase Itch and p73 modular adapter protein Yap-1 in HeLa cells (data not shown). Both Yap-1 and Itch bind the same PPPY motif of p73, resulting in stabilization of p73 by Yap-1 and prevention of Itch-mediated ubiquitination of p73 (31). Our data favor the hypothesis that netrin-1 targets the activation status of p73 ubiquitin/deubiquitin ligases.
We therefore sought to determine the effect of netrin-1 and DCC on the ubiquitination levels of p73
after cotransfection of HEK-293 cells with expression vectors encoding His6-c-Myc–tagged human ubiquitin, β-galactosidase, and TAp73
(Fig. 4A
). Quantification of TAp73
ubiquitination (bottom) was performed by densitometry analysis of the wt-TAp73
protein (arrow) and its cleaved forms, both normalized to the relative amounts of total TAp73
detected by direct Western blot (top). In two separate experiments, we observed that netrin-1 reduced by 62% and 63% the ubiquitination levels of the full-length and cleaved forms of the TAp73
protein in HEK-293 cells. Conversely, wt-DCC increased by 15% and 61% the ubiquitination levels of the cleaved and wt forms of TAp73
, respectively. Upon cotransfection with netrin-1 + DCC, these two ubiquinated bands were respectively reduced by 61% and 22%. We next examined the turnover of TAp73
in the presence and absence of ectopically expressed Netrin-1 (Fig. 4B). Twenty four hours posttranfection of HEK-293 cells with TAp73
and Netrin-1 or control vectors, these cells were treated with the translation inhibitor cycloheximide for 0, 1, 2, 4, and 6 hours. TAp73
protein levels were monitored by Western blot and normalized to β-actin. As shown in Fig. 4B, netrin-1 clearly stabilizes TAp73
protein levels leading to a significant increase in protein half-life.

View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4. Differential effect of Netrin-1 and DCC on the p73 ubiquitination levels. A, HEK-293 cells were cotransfected with the constant amount of the TA-p73 , β-gal, and pMyc-Ub expression vectors, in the presence or absence of the Netrin-1 and DCC vectors, as indicated (top). At 40 h posttransfection, cells were treated with MG132 (10 µmol/L) for 8 h. Cell lysates were then prepared, and total proteins were analyzed by direct Western blotting, using the same antibodies. Bottom, the ubiquitinated proteins were recovered from total cell lysates by immunoprecipitation with Ni-NTA-agarose beads, followed by immunoblotting with the anti-SAM domain p73 antibody. The β-galactosidase activity was measured to normalize the transfection efficiency. Data were quantified by densitometry as TA-p73 ubiquitination signals corresponding to the full-length and cleaved forms of TAp73 bands normalized according to the TAp73 protein detected by direct Western blot. Data are representative of another experiment. B, HEK-293 cells were transfected with TAp73 alone or together with Netrin-1 or control vectors. Top, at 24 h posttransfection, the cells were treated with 50 µg/mL cycloheximide and harvested at the time points shown for TAp73 and β-actin immunoblot analysis. Bottom, densitometric analysis of the TAp73 bands relative to β-actin were measured and plotted on a graph. Data are representative of two separate experiments.
|
|
Netrin-1 and DCC selectively potentiate alterations of cell viability induced by cisplatin. Given that TAp73
is recognized as an important mediator of the apoptosis induced by cisplatin, we next tested whether netrin-1 and DCC interfere with alterations of HeLa cell viability induced by cisplatin and doxorubicin, two chemotherapeutic drugs with different modes of action. As a topoisomerase type II inhibitor and intercalating agent, the anthracycline antibiotic doxorubicin induces breaks in the genomic DNA and blocks DNA synthesis and transcription. The cytotoxicity of the DNA-damaging agent cisplatin is achieved in part through inhibition of DNA replication and transcription, and induction of the DNA damage response signaling pathways involved in the transduction of genotoxic stress signals to the p53 and p73 regulators of cell cycle arrest and apoptosis. First, we established the inhibitory potency of cisplatin and doxorubicin in control HeLa cells (Fig. 5, top
). We observed that 10 µmol/L cisplatin and 0.6 µmol/L doxorubicin induced a reduction of
50% in HeLa cell viability. Both netrin-1 and DCC ectopic expression increased the cytotoxicity of cisplatin (Fig. 5, bottom), compared with control vector-transfected cells (P < 0.001). It is noteworthy that when HeLa cells were transfected with the same netrin-1 and DCC-encoding vectors, we observed no change in cell viability over the doxorubicin-only treatment.

View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 5. Netrin-1 and DCC cooperate with cisplatin-induced alterations of cell viability. Top, HeLa cells were incubated for 48 h with increasing concentrations of cisplatin (left) or doxorubicin (Dox; right). The inhibitory potency (IC50) of each drug was measured according to the concentration giving half-maximal inhibition of cell viability, using the MTT test; bottom, HeLa cells were transfected with control vector alone (vector) and expression vectors encoding either Netrin-1, wt-DCC, or their combination (Net + DCC), as indicated. At 24 h posttransfection, nontransfected cells (control) and transiently transfected cells were treated for 48 h with the IC50 drug concentrations (cisplatin, 10 µmol/L; doxorubicin, 0.6 µmol/L), and cell viability was determined by MTT assay. Data are expressed as the percentage of the initial cell viability measured in nontransfected control cells, resulting in 50% to 60% residual viability measured in the presence of each anticancer drug tested at their corresponding IC50. Columns, mean from three independent experiments, each performed in triplicate; bars, SE. Significant differences at P < 0.001 (*) versus control vector.
|
|
Effect of external addition of the netrin-1 peptide on TAp73
levels and HeLa cell viability. Further proof of the role of netrin-1 on TAp73
expression and cell viability was provided from HeLa cells stably transfected by expression vectors encoding either p73 silencing shRNAs (sh-RNA-p73) or control sh-scrambled sequences (sh-CON). The effect of external addition of the netrin-1 peptide was investigated on TAp73
protein and the MTT test. As shown in Fig. 6A
, the robust induction of p73
protein levels by cisplatin, observed in the sh-CON HeLa cells, was alleviated by the p73 shRNAs, as expected from the validation of the silenced versus the scrambled control clones. In agreement, p73
silencing exacerbates the growth of HeLa tumor xenografts in nude mice, with no effect on the invasive potential of HeLa cells in collagen type I gels (Fig. 6B) and in subcutaneous tumors (Supplementary Fig. S2B). In both groups,
75% of tumor xenografts were found invasive. The percentage of Ki-67–positive tumors in p73-silenced cells (26.8%) was significantly higher than the percentage in the corresponding control xenografts (7.6%; P < 0.01), whereas the number of TUNEL-positive cells was higher in control versus p73-silenced cells (respectively, 22.4% and 3.1%; P < 0.01). Consistently, stable silencing of p73
resulted in remarkable induction of the antiapoptotic protein Bcl-2 in sh-RNA-p73 HeLa cells (data not shown). Taken together, our data support the functional validation of the p73
-silenced HeLa cells in the context of cancer cell proliferation and apoptosis in vitro and in vivo. As shown in Fig. 6C, the netrin-1 peptide and cisplatin induced a robust accumulation of TAp73
and compromised HeLa cell viability to similar extent in sh-CON HeLa cells but not in silenced p73-shRNA cells.

View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 6. Impact of stable expression of p73 shRNAs and Netrin-1 on HeLa cell viability, invasion, and tumorigenicity. A, validation of p73 stable silencing by SDS-PAGE and immunoblot analysis in HeLa cells stably transfected with the sh-CON (clones 1 and 3) or shRNA-p73 constructs (clones 1 and 2). Top, the sh-CON and shRNA-p73 clones were incubated for 48 h in the presence (+) or absence of 10 µmol/L cisplatin (–); effect of external addition of the Netrin-1 peptide on the expression levels of TA-p73 . Stably transfected cells were treated for 8 h with the proteasome inhibitor MG132 (10 µmol/L) and then exposed for 48 h in the presence (+) or absence of Netrin-1 in the presence of MG132 (–). B, effect of stable expression of shRNAs targeting p73 on collagen type I gel invasion and growth of HeLa tumor cell xenografts in immunodeficient mice. Top, collagen type I invasion assays were done as described (14) using stable transfectants of HeLa cells expressing p73 interferring shRNAs (shRNA-p73) or their control counterparts (sh-CON scrambled sequences). Invasive and superficial HeLa sh-CON and shRNA-p73 –silenced cells adherent to collagen type I gels were counted in 12 fields of 0.157 mm2 using an inverted microscope, representing a total of 250 to 300 cells examined and screened for each experimental condition. Invading cells were scored as described in the Materials and Methods section. Netrin-1 was ineffective to further increase the spontaneous invasive phenotype observed in sh-CON and shRNA-p73 HeLa cells (data not shown). Columns, mean from three independent experiments; bars, SE. Bottom, xenografts were induced by s.c. injections of 4 x 106 cells (HeLa sh-CON, clone 1; shRNA-p73, clone 1) in female severe combined immunodeficient CB17 mice, 6 mice (6- to 8-wk-old, 6 mice per group). Tumor dimensions were measured every week, and the volume (V, mm3) calculated as V = (L2 x W)/6, L and W being the length and width of the tumor xenografts. All experiments were conducted in agreement with the guidelines of the Animal Care Committee. The growth of the HeLa-induced tumors was exacerbated by p73 silencing (*, P < 0.05). C, cell viability evaluated by the MTT assay in HeLa sh-CON (clone 1) and shRNA-p73 cells (clone 1) challenged for 48 h with cisplatin (10 µmol/L), Netrin-1, and their combination. Netrin-1 treatment (100 ng/mL) was repeated every 12 h. Data are from three separate experiments and are expressed as the percentage of the respective control values. Similar data are observed with the HeLa sh-CON clone 3 and the shRNA-p73 clone 2. Significant differences (*, P < 0.01) versus control conditions.
|
|
 |
Discussion
|
|---|
The implication of the p53, p63, and p73 family proteins on gene transcription and regulation of several effectors involved in cell cycle control, tumor progression, cancer cell survival, and apoptosis has been largely documented in the literature. In the present study, we bring original data on the conditional regulation of apoptosis induced by netrin-1 and DCC in p53-deficient HeLa and HEK-293 cells. The pertinence of these two models for our study and objectives is validated by the observation that the TP53 tumor suppressor gene is commonly lost or mutated in human solid tumors. Deficiency of p53 disrupts anticancer drug–induced apoptosis and promotes resistance to chemotherapy and a more malignant phenotype. In contrast, the p73 and p63 proteins are rarely mutated in human tumors and are mainly regulated via complex transcriptional and posttranscriptional mechanisms. Because extensive crosstalk among the p53 family members and their isoforms has been reported, our approach therefore facilitates the interpretation of our data under a relevant context of carcinogenesis.
We showed that netrin-1 exerts two divergent functions on cell survival by inducing apoptosis in the absence of DCC, and blocking the apoptosis induced by the DCC tumor suppressor protein, according to the dependence receptor hypothesis. Our data indicate that the cell death pathways induced by netrin-1 and DCC are mutually exclusive. Netrin-1 induced convergent deleterious signals against cancer cell viability and survival as evidenced by the MTT test and determination of apoptosis in the sub-G1 fraction by FACS analysis and TUNEL assay. Netrin-1 induced caspase-3 cleavage and decreased the Bcl-2/Bax ratio, underlying its capacity to induce apoptosis through the mitochondrial pathway. Phenotypic effects of netrin-1 on viability and apoptosis were associated with the selective induction of the long TAp73
protein isoform in HeLa and HEK-293 cells, suggesting that netrin-1 is a potential regulator of apoptosis and gene expression via TAp73
. Indeed, the TAp73
isoform exhibits proapoptotic functions and transactivates several p53 target genes involved in cell cycle arrest and apoptosis. In our study, however, the induction of TAp73
protein by netrin-1 did not correlate with any change in the distribution of HeLa cells within the different phases of the cell cycle, suggesting a selective effect of netrin-1 on survival in cancer cells with compromised p53. In addition, no induction of the
Np73
short isoform was seen by qRT-PCR and immunoblotting in netrin-1–expressing cells. The
Np73
short isoform is associated with cell survival, and functions as a dominant negative competitor of TAp73
, due to inhibitory hetero-oligomer formation (32). Consistently, the
N isoforms of p73 and p63 are frequently overexpressed in cancer. However, no effect on p63 protein levels was detected after netrin-1 expression, thus showing selective netrin-1 regulation at the p73 signaling network. This observation is compatible with the notion that p63 regulates progenitor cell populations and morphogenesis at the proliferation-differentiation interface in the epithelial and mesenchymal cell lineages, as shown in p63 loss-of-function mouse models (33). Knockdown of p63 expression by shRNA in mammary epithelial cells caused both cell detachment and anoïkis associated with down-regulation of cell adhesion-associated genes encoding β1, β4, and
6 integrins, as well as laminin-
2 and fibronectin (34). Interestingly, both
6β4 and
3β1 integrins are now considered as functional netrin-1 receptors (35).
In this report, we have shown that netrin-1 selectively up-regulates TAp73
levels through posttranscriptional mechanisms, including inhibition of p73
ubiquitination, stabilization of the p73
protein, with no change in the expression levels of the p73
ubiquitination effectors Itch and Yap-1 (31, 36). In agreement, the induction of the TAp73
protein levels by netrin-1 synergizes with the proteasome inhibitor MG132. Of note, netrin-1 was ineffective on the Tyr-99 phosphorylation levels of TAp73
targeted by the abl tyrosine kinase (data not shown), and involved in the stability of p73. Implication of cyclin-Cdk complexes, acetylation-dependent mechanisms, and ubiquitin-independent pathways using the 20S proteasome were also reported for regulating p73 stability and degradation (37–39). Another possibility is that netrin-1 regulates the translation of the p73
mRNA as recently illustrated by the elegant study of Tsai showing that netrin-1 alleviated the Grb7-mediated translational repression of the
opioid receptor mRNA via a netrin-1/integrin/FAK and Grb-7 pathway (40). Other key signaling molecules involved in cancer cell survival and progression, including DCC and src, are potentially involved in this FAK molecular scaffold (41). Consistent with this hypothesis, our data indicate that the cell death factor DCC is not competent to induce TAp73
protein levels but conversely counteracts netrin-induced TAp73
protein accumulation. Another divergent mechanism underlying the apoptosis induced by netrin-1 and DCC is illustrated by the observation that DCC is highly efficient in TAp73
ubiquitination. Additional mechanisms may include the participation of microRNAs in regulating apoptosis sensitivity to netrin-1, DCC, and TAp73
(42).
The implication of the TAp73
signal on the apoptosis induced by netrin-1 was shown by transient and stable silencing the endogenous p73
protein levels. Our data therefore indicate that TAp73
is a relevant mediator of the apoptosis induced by netrin-1. Identification of the netrin signaling effectors and target genes induced via TAp73
should provide more information on the signaling networks involved in the apoptosis induced by netrin-1. This question is sustained by the positive cooperativity we have observed between netrin-1/DCC on the cisplatin cytotoxicity in HeLa cells. Recent advances in the field indicate that TAp73
increases the sensitivity to chemotherapeutic drugs and oxidative stress and is involved in the limitation of anchorage-independent growth (43).
In the present study, we found that netrin-1 induced apoptosis in DCC-deficient HeLa cells. Emerging evidence underline the molecular and functional diversity of the netrin ligands, receptors and coreceptors (DCC-adenosine A2B, UNC5A to 5D, neogenin, integrins/FAK, as well as unidentified netrin-1 receptors), and their interplay or antagonism regarding angiogenesis, apoptosis, and survival in cancer cells (35, 44–46). Another level of complexity is illustrated by the formation of homodimers and heterodimers between the cell death family netrin receptors, as shown during axon attraction and repulsion (47). We have shown that DCC-deficient human colon cancer cells and tumors retain UNC5 netrin receptors A to B and C (14). In contrast, expression of the netrin-1 gene NTN1 is reduced or absent in brain and prostate cancers (48, 49), suggesting that cell death signals induced by netrin-1 can be abrogated during oncogenesis. Divergent biological roles of netrin-1 in attraction, retraction or repulsion of neuronal, endothelial, and epithelial cells are also reported according to the cellular and signaling context (12, 46, 50). Therefore, different known or unknown netrin receptors can be sequentially and reciprocally activated, desensitized/internalized, or degraded. Recent data indicate that the dependence receptors UNC5A regulate naturally occurring apoptosis independently of netrin-1 and, therefore, do not provide support for the dependence ligand hypothesis (45). Netrins are secreted and diffusible molecules that are stored together with several growth factors and matricellular proteins at the vicinity of cancer cells and tumor stromal cells. These paracrine and autocrine factors have potential long-lasting effect on the survival and spreading of cancer cells in primary human solid tumors and their metastases, including the modulation of cell death and DNA damage signals induced during cancer therapeutics.
 |
Disclosure of Potential Conflicts of Interest
|
|---|
No potential conflicts of interest were disclosed.
 |
Acknowledgments
|
|---|
Grant support: Institut National de la Sante et de la Recherche Medicale, ARC n°3765, IPSEN, the Fund for Scientific Research Flanders (Brussels, Belgium), and the Scientific Exchange Program between the Flemish community and France (Grant I. 2007.03).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
Footnotes
|
|---|
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).
J-P. Roperch, K. El Ouadrani, O. De Wever, and G. Melino contributed equally to this work.
Received 4/21/08.
Revised 7/11/08.
Accepted 7/29/08.
 |
References
|
|---|
- Fearon ER, Cho KR, Nigro JM, et al. Identification of a chromosome 18q gene that is altered in colorectal cancers. Science 1990;247:49–56.[Abstract/Free Full Text]
- Ogi K, Toyota M, Ohe-Toyota M, et al. Aberrant methylation of multiple genes and clinicopathological features in oral squamous cell carcinoma. Clin Cancer Res 2002;8:3164–71.[Abstract/Free Full Text]
- Tamura G. Promoter methylation status of tumor suppressor and tumor-related genes in neoplastic and non-neoplastic gastric epithelia. Histol Histopathol 2004;19:221–8.[Medline]
- Carvalho AL, Chuang A, Jiang WW, et al. Deleted in colorectal cancer is a putative conditional tumor-suppressor gene inactivated by promoter hypermethylation in head and neck squamous cell carcinoma. Cancer Res 2006;66:9401–7.[Abstract/Free Full Text]
- Bernet A, Mazelin L, Coissieux MM, et al. Inactivation of the UNC5C Netrin-1 receptor is associated with tumor progression in colorectal malignancies. Gastroenterology 2007;133:1840–8.[CrossRef][Medline]
- Taylor KH, Pena-Hernandez KE, Davis JW, et al. Large-scale CpG methylation analysis identifies novel candidate genes and reveals methylation hotspots in acute lymphoblastic leukemia. Cancer Res 2007;67:2617–25.[Abstract/Free Full Text]
- Arakawa H. Netrin-1 and its receptors in tumorigenesis. Nat Rev Cancer 2004;4:978–87.[CrossRef][Medline]
- Bernet A, Mehlen P. Dependence receptors: when apoptosis controls tumor progression. Bull Cancer 2007;94:E12–7.[Medline]
- Shekarabi M, Kennedy TE. The netrin-1 receptor DCC promotes filopodia formation and cell spreading by activating Cdc42 and Rac1. Mol Cell Neurosci 2002;19:1–17.[CrossRef][Medline]
- Meriane M, Tcherkezian J, Webber CA, et al. Phosphorylation of DCC by Fyn mediates Netrin-1 signaling in growth cone guidance. J Cell Biol 2004;167:687–98.[Abstract/Free Full Text]
- Ren XR, Ming GL, Xie Y, et al. Focal adhesion kinase in netrin-1 signaling. Nat Neurosci 2004;7:1204–12.[CrossRef][Medline]
- Wilson BD, Ii M, Park KW, et al. Netrins promote developmental and therapeutic angiogenesis. Science 2006;313:640–4.[Abstract/Free Full Text]
- Grady W. Making the case for DCC and UNC5C as tumor suppressor genes in the colon. Gastroenterology 2007;133:2045–9.[CrossRef][Medline]
- Rodrigues S, De Wever O, Bruyneel E, Rooney RJ, Gespach C. Opposing roles of netrin-1 and the dependence receptor DCC in cancer cell invasion, tumor growth and metastasis. Oncogene 2007;26:5616–25.
- Melino G, De Laurenzi V, Vousden KH. p73: friend or foe in tumorigenesis. Nat Rev Cancer 2002;2:605–15.[CrossRef][Medline]
- Gaiddon C, Lokshin M, Ahn J, Zhang T, Prives C. A subset of tumor-derived mutant forms of p53 down-regulate p63 and p73 through a direct interaction with the p53 core domain. Mol Cell Biol 2001;21:1874–87.[Abstract/Free Full Text]
- Murray-Zmijewski F, Lane DP, Bourdon JC. p53/p63/p73 isoforms: an orchestra of isoforms to harmonise cell differentiation and response to stress. Cell Death Differ 2006;13:962–72.[CrossRef][Medline]
- Rocco JW, Leong CO, Kuperwasser N, DeYoung MP, Ellisen LW. p63 mediates survival in squamous cell carcinoma by suppression of p73-dependent apoptosis. Cancer Cell 2006;9:45–56.[CrossRef][Medline]
- Domínguez G, García JM, Peña C, et al.
TAp73 upregulation correlates with poor prognosis in human tumors: putative in vivo network involving p73 isoforms, p53, and E2F-1. J Clin Oncol 2006;24:805–15.[Abstract/Free Full Text] - Grob TJ, Novak U, Maisse C, et al. Human
Np73 regulates a dominant negative feedback loop for TAp73 and p53. Cell Death Differ 2001;8:1213–23.[CrossRef][Medline] - Petrenko O, Zaika A, Moll UM.
Np73 facilitates cell immortalization and cooperates with oncogenic Ras in cellular transformation in vivo. Mol Cell Biol 2003;23:5540–55.[Abstract/Free Full Text] - Casciano I, Mazzocco K, Boni L, et al. Expression of
Np73 is a molecular marker for adverse outcome in neuroblastoma patients. Cell Death Differ 2002;9:246–51.[CrossRef][Medline] - Marin MC, Jost CA, Irwin MS, DeCaprio JA, Caput D, Kaelin WG. Viral oncoproteins discriminate between p53 and the p53 homolog p73. Mol Cell Biol 1998;18:6316–24.[Abstract/Free Full Text]
- Urist M, Tanaka T, Poyurovsky MV, Prives C. p73 induction after DNA damage is regulated by checkpoint kinases Chk1 and Chk2. Genes Dev 2004;18:3041–54.[Abstract/Free Full Text]
- Sayan AE, Paradisi A, Vojtesek B, Knight RA, Melino G, Candi E. New antibodies recognizing p73: comparison with commercial antibodies. Biochem Biophys Res Commun 2005;330:186–93.[CrossRef][Medline]
- De Laurenzi V, Costanzo A, Barcaroli D, et al. Two new p73 splice variants,
and
, with different transcriptional activity. J Exp Med 1998;188:1763–8.[Abstract/Free Full Text] - Ward CL, Omura S, Kopito RR. Degradation of CFTR by the ubiquitin-proteasome pathway. Cell 1995;83:121–7.[CrossRef][Medline]
- Reale MA, Hu G, Zafar AI, Getzenberg RH, Levine SM, Fearon ER. Expression and alternative splicing of the deleted in colorectal cancer (DCC) gene in normal and malignant tissues. Cancer Res 1994;54:4493–501.[Abstract/Free Full Text]
- Kim TH, Lee HK, Seo IA, et al. Netrin induces down-regulation of its receptor, Deleted in Colorectal Cancer, through the ubiquitin-proteasome pathway in the embryonic cortical neuron. J Neurochem 2005;95:1–8.[CrossRef][Medline]
- Watson IR, Irwin MS. Ubiquitin and ubiquitin-like modifications of the p53 family. Neoplasia 2006;8:655–66.[CrossRef][Medline]
- Levy D, Adamovich Y, Reuven N, Shaul Y. The Yes-associated protein 1 stabilizes p73 by preventing Itch-mediated ubiquitination of p73. Cell Death Differ 2007;14:743–51.[CrossRef][Medline]
- Slade N, Zaika AI, Erster S, Moll UM.
Np73 stabilises TAp73 proteins but compromises their function due to inhibitory hetero-oligomer formation. Cell Death Differ 2004;11:357–60.[CrossRef][Medline] - Yang A, Schweitzer R, Sun D, et al. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 1999;398:714–8.[CrossRef][Medline]
- Carroll DK, Carroll JS, Leong CO, et al. p63 regulates an adhesion programme and cell survival in epithelial cells. Nat Cell Biol 2006;8:551–61.[CrossRef][Medline]
- Yebra M, Montgomery AM, Diaferia GR, et al. Recognition of the neural chemoattractant Netrin-1 by integrins
6β4 and
3β1regulates epithelial cell adhesion and migration. Dev Cell 2003;5:695–07.[CrossRef][Medline] - Danovi SA, Rossi M, Gudmundsdottir K, Yuan M, Melino G, Basu S. Yes-associated protein (YAP) is a critical mediator of c-Jun-dependent apoptosis. Cell Death Differ 2008;15:217–9.[CrossRef][Medline]
- Melino G, Lu X, Gasco M, Crook T, Knight RA. Functional regulation of p73 and p63: development and cancer. Trends Biochem Sci 2003;28:663–70.[CrossRef][Medline]
- Asher G, Tsvetkov P, Kahana C, Shaul Y. A mechanism of ubiquitin-independent proteasomal degradation of the tumor suppressors p53 and p73. Genes Dev 2005;19:316–21.[Abstract/Free Full Text]
- Paliwal P, Radha V, Swarup G. Regulation of p73 by Hck through kinase-dependent and independent mechanisms. BMC Mol Biol 2007;8:45.[CrossRef][Medline]
- Tsai NP, Bi J, Wei LN. The adaptor Grb7 links netrin-1 signaling to regulation of mRNA translation. EMBO J 2007;26:1522–31.[CrossRef][Medline]
- Li W, Aurandt J, Jürgensen C, Rao Y, Guan KL. FAK and Src kinases are required for netrin-induced tyrosine phosphorylation of UNC5. J Cell Sci 1998;119:47–55.[CrossRef]
- Park SM, Peter ME. microRNAs and death receptors. Cytokine Growth Factor Rev 2008;19:303–11.[CrossRef][Medline]
- Beitzinger M, Hofmann L, Oswald C, et al. p73 poses a barrier to malignant transformation by limiting anchorage-independent growth. EMBO J 2008;27:792–803.[CrossRef][Medline]
- Park KW, Crouse D, Lee M, et al. The axonal attractant Netrin-1 is an angiogenic factor. Proc Natl Acad Sci U S A 2004;101:16210–5.[Abstract/Free Full Text]
- Williams ME, Lu X, McKenna WL, et al. UNC5A promotes neuronal apoptosis during spinal cord development independent of netrin-1. Nat Neurosci 2006;9:996–8.[CrossRef][Medline]
- Larrivée B, Freitas C, Trombe M, et al. Activation of the UNC5B receptor by Netrin-1 inhibits sprouting angiogenesis. Genes Dev 2007;21:2433–47.[Abstract/Free Full Text]
- Hong K, Hinck L, Nishiyama M, Poo MM, Tessier-Lavigne M, Stein E. A ligand-gated association between cytoplasmic domains of UNC5 and DCC family receptors converts netrin-induced growth cone attraction to repulsion. Cell 1999;97:927–41.[CrossRef][Medline]
- Meyerhardt JA, Caca K, Eckstrand BC, et al. Netrin-1: interaction with deleted in colorectal cancer (DCC) and alterations in brain tumors and neuroblastomas. Cell Growth Differ 1999;10:35–42.[Abstract/Free Full Text]
- Latil A, Chêne L, Cochant-Priollet B, et al. Quantification of expression of netrins, slits and their receptors in human prostate tumors. Int J Cancer 2003;103:306–15.[CrossRef][Medline]
- Bartoe JL, McKenna WL, Quan TK, et al. Protein interacting with C-kinase 1/protein kinase C
-mediated endocytosis converts netrin-1-mediated repulsion to attraction. J Neurosci 2006;26:3192–205.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
C. Delloye-Bourgeois, J. Fitamant, A. Paradisi, D. Cappellen, S. Douc-Rasy, M.-A. Raquin, D. Stupack, A. Nakagawara, R. Rousseau, V. Combaret, et al.
Netrin-1 acts as a survival factor for aggressive neuroblastoma
J. Exp. Med.,
April 13, 2009;
206(4):
833 - 847.
[Abstract]
[Full Text]
[PDF]
|
 |
|