Cancer Research Targets  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 8333, October 15, 2008. doi: 10.1158/0008-5472.CAN-08-0080
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kashiwakura, Y.
Right arrow Articles by Kumon, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kashiwakura, Y.
Right arrow Articles by Kumon, H.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Down-regulation of Inhibition of Differentiation-1 via Activation of Activating Transcription Factor 3 and Smad Regulates REIC/Dickkopf-3–Induced Apoptosis

Yuji Kashiwakura1, Kazuhiko Ochiai1, Masami Watanabe1,2, Fernando Abarzua2, Masakiyo Sakaguchi3, Munenori Takaoka1, Ryuta Tanimoto2, Yasutomo Nasu1,2, Nam-ho Huh3 and Hiromi Kumon1,2

1 Innovation Center Okayama for Nanobio-Targeted Therapy and Departments of 2 Urology and 3 Cell Biology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Okayama, Japan

Requests for reprints: Yuji Kashiwakura, Innovation Center Okayama for Nanobio-Targeted Therapy, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, Shikata 2-5-1, Okayama 700-8558, Japan. Phone/Fax: 81-86-235-6625; E-mail: yu-kashi{at}cj9.so-net.ne.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
REIC/Dickkopf-3 (Dkk-3), a tumor suppressor gene, has been investigated in gene therapy studies. Our previous study suggested that REIC/Dkk-3–induced apoptosis mainly resulted from phosphorylation of c-Jun-NH2 kinase (JNK) in prostate cancer cells. However, the precise mechanisms, especially the molecular mechanisms regulating JNK phosphorylation, remain unclear. In this study, we investigated the mechanisms participating in JNK phosphorylation in the context of a refractory cancer disease, malignant mesothelioma (MM). Adenovirus-mediated overexpression of REIC/Dkk-3 induced apoptosis mainly through JNK activation in immortalized MM cells (211H cells). Interestingly, transcriptional down-regulation of inhibition of differentiation-1 (Id-1) was detected in REIC/Dkk-3–overexpressed 211H cells. Moreover, restoration of Id-1 expression antagonized REIC/Dkk-3–induced JNK phosphorylation and apoptosis. Mutagenesis experiments with the 2.1-kb human Id-1 promoter revealed that activating transcription factor 3 (ATF3) and Smad interaction, with their respective binding motifs, was essential for REIC/Dkk-3–mediated suppression of Id-1 promoter activity. ATF3 activation was probably induced by endoplasmic reticulum stress. Finally, we showed strong antitumor effects from REIC/Dkk-3 gene transfer into the pleural cavity in an orthotopic MM mouse model. Relative to control tumor tissue, REIC/Dkk-3–treated tumor tissue showed down-regulated expression of Id-1 mRNA, enhanced expression of phosphorylated JNK, and an increased number of apoptotic cells. In summary, we first showed that both ATF3 and Smad were crucially and synergistically involved in down-regulation of Id-1, which regulated JNK phosphorylation in REIC/Dkk-3–induced apoptosis. Thus, gene therapy with REIC/Dkk-3 may be a promising therapeutic tool for MM. [Cancer Res 2008;68(20):8333–41]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
It has been suggested that the Dickkopf (Dkk) gene family inhibits Wnt signaling, leading to the suppression of pleiotropic effects in critical biological contexts, including development, cell growth/differentiation, and cancer (1, 2). Although the four genes of the Dkk family known to exist in humans have not been completely characterized, they have important functions as well. We previously identified REIC/Dkk-3 as a gene whose expression is reduced in numerous human cancers and showed its function as a tumor suppressor gene (3). Adenovirus-mediated overexpression of REIC/Dkk-3 induced apoptosis through the activation of c-Jun-NH2 kinase (JNK; ref. 4). However, the precise mechanism of REIC/Dkk-3–induced apoptosis, especially the mechanism involving in JNK phosphorylation, remains unclear.

Inhibition of differentiation-1 (Id-1) proteins are a class of dominant-negative antagonists of helix-loop-helix transcription factors. It lacks the basic domain for DNA binding and functions by forming heterodimers, thus inhibiting gene expression (5, 6). Although the exact role of Id-1 in cancer initiation and development is still controversial, it is obviously to be involved in tumor biology (cell proliferation, antiapoptosis, angiogenesis, and effects on invasion) of numerous types of cancers (7). Ectopic Id-1 expression causes activation of the mitogen-activated protein kinase signaling pathway, thus leading to cancer cell proliferation. Recent reports have shown that Id-1 offers resistance to tumor necrosis factor-{alpha} (TNF-{alpha})–induced or anticancer drug–induced apoptosis in various cancer cell lines (810). The deregulation of the Bcl-2 family genes, Bax, Bcl-2, or Bcl-xL, mediates the Id-1 antiapoptotic effect. In addition, various signaling pathways, including nuclear factor-{kappa}B (NF-{kappa}B), Raf/MEK, Akt, and JNK participate in the process (1013). Thus, it is possible that down-regulation of Id-1 is a key event in cancer cell apoptosis.

Malignant mesothelioma (MM) is a refractory malignant disease of serosal surfaces, such as the pleura and peritoneum. Despite considerable advances in the general understanding of its etiology and pathogenesis, MM remains incurable with standard cancer therapy modalities (14, 15). Furthermore, this tumor has been predicted to increase the social burden by raising health care costs and the costs paid by industry and government in the form of compensation. Nevertheless, no definitive treatment strategy has yet been established to improve the clinical outcome of MM.

Here, to better understand the anticancer molecular mechanisms of REIC/Dkk-3 and to establish a potential application of REIC/Dkk-3 gene therapy for MM, we examined the molecular mechanisms of transcriptional down-regulation of Id-1 in REIC/Dkk-3–overexpressed MM immortalized cells and investigated the possible therapeutic effects of REIC/Dkk-3 gene transfer in a MM orthotopic mouse model.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Cell culture. Four human MM cell line (211H, H28, H2052, H2452) and HeLa cells were purchased from the American Type Culture Collection. Cells were maintained in RPMI 1640 [Life Technologies-Bethesda Research Laboratories (BRL)] supplemented with 10% dialyzed fetal bovine serum (FBS;Life Technologies-BRL), 2 mmol/L glutamine, penicillin (100 units/mL), and streptomycin (100 µg/mL) at 37°C in a humidified atmosphere of 5% CO2.

Antibodies. Rabbit anti-human REIC/Dkk-3 antibodies were produced in our laboratory (4). The other antibodies used were as follows: mouse anti-human {alpha}-tubulin antibody (Sigma); rabbit anti-human c-Jun antibody, rabbit anti-human phosphorylated c-Jun (Ser63) antibody, rabbit anti-human stress-activated protein kinase/JNK antibody, and rabbit anti-human phosphorylated stress-activated protein kinase/JNK (Thr183/Tyr185) antibody, cleaved (active) caspase-3 (Asp175; Cell Signaling Technology); rabbit anti-human Id1 antibody (Santa Cruz); rabbit anti-human CHOP (Abcam); rabbit anti-human phosphorylated eIF2{alpha} (Abcam); anti-human phosphorylated IRE1{alpha} (Novus Biochemicals); rabbit anti-human Bip (Cell Signaling Technology); activating transcription factor 3 (ATF3)/cAMP-responsive element binding protein (CREB; Santa Cruz); pSmad3 (Cell Signaling Technology); pSmad1 (Santa Cruz); and LacZ (Santa Cruz).

Stable transfectant. 211H cells stably expressing luciferase gene (211H/Luc) was made by transfection of pIRES-puro3-luciferase plasmid (Clontech), as previously described (G418, 500 µg/mL; ref. 16).

Adenovirus production. Both REIC/Dkk-3 and Id-1 adenovirus were produced and propagated, as described previously (4).

Western blot. Cell lysates were prepared using M-PER mammalian protein extraction reagent (Pierce). Gel electrophoresis and Western blot analysis were performed under conventional conditions. Each specific antibody binding was detected with horseradish peroxidase (HRP)–conjugated respective IgG antibodies with enhancement by ECL Plus Western Blotting Detection System (GE Healthcare). For all experiments, 20 µg of protein were applied to each well beside {alpha}-tubulin. Five micrograms of protein were applied to the {alpha}-tubulin well.

Tunnel assay. To examine in vitro apoptosis induction after the treatments, cells were seeded in flat-bottomed six-well plates and incubated for 24 hours. The cells were treated with the Ad-LacZ or Ad-REIC at the indicated multiplicities of infection (MOI) in serum-free medium for 2 hours, and the medium was exchanged to the flesh complete medium. After 48 hours incubation, apoptotic cells were determined using the in situ Cell Death Detection Fluorescein kit from Roche Diagnostics following the manufacturer's instructions. The apoptotic cells were counted under a microscope. The apoptotic percentage was defined by the number of cells with green nucleus among the total number of cells in each sample (100 cells were judged under one field). For one experiment, apoptotic cells were counted at five different fields of the microscopic observation, and average percentage of apoptotic cell was calculated. All experiments were done thrice independently. The data present are representative of one. For tissue Tunnel assay, tumor section was frozen within OTC at –70°C. Frozen tissues were cut with 7-µm thickness and mounted on cover glass slides followed by fixation with 4% paraformaldehyde. The fixed tissue was permeabilized with 0.1% citric acid and 0.1% Triton X-100 (Sigma) and then used for Tunnel staining. We basically followed the protocol provided with the in situ Cell Death Detection Fluorescein kit from Roche Diagnostics. Apoptotic percentage was calculated as in vitro Tunnel assay.

Reverse transcription–PCR. Total RNA from culture dish was extracted using ISOGEN (Nippon Gene), as descried previously (16). After DNase I (Qiagen) treatment, total RNA was reverse-transcribed using Superscript II (Invitrogen) with random hexamer primers. For reverse transcription–PCR (RT-PCR), the resultant cDNAs were amplified with Taq polymerase (Takara) in a thermocycler. The primer pairs used were as follows: for human Id-1, 5'-AACCGCAAGGTGAGCAAGGT/GCGCTTCAGCGACACAAGAT-3' (218 bp PCR product); for β-actin, 5'-AAGAGAGGCATCCTCACCCT/TACATGGCTGGGGTGTTGAA-3' (218 bp PCR product). Thermal cycling was performed for 20 cycles. Each cycle consisted of 30 s of denaturation at 94°C, 30 s of annealing at 60°C, and 30 s of extension at 72°C.

Id-1 promoter assay. Human 2.1 kb Id-1 promoter was kindly provided from Dr. Katagiri (Showa University; ref. 17). As shown in Fig. 3A, several mutations on Id-1 promoter were created by mutagenesis kit (Stratagene) followed by sequence confirmation. Four hundred nanograms of the plasmid with 100 ng of internal control plasmid (pGL4.74-Renilla gene driven by HSVtk promoter; Promega) were cotransfected to the 211H cells in a 24-well dish by Lipofectamine 2000 methods (Invitrogen). Adenoviurs vectors or thapsigargin (TPG; Sigma) were used in treating the transfected cells at 48 h after transfection. Light absorption was determined at 24 h after adenovirus vector or TPG treatment. All experiments were done thrice independently. The data present are representative of one.


Figure 3
View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Activation of ATF3 and Smad mediated the suppression of Id-1 promoter activity by REIC/Dkk-3 overexpression. A, mutated sequences in binding motifs of several transcription factors in the human Id-1 5' flanking promoter region. B, luciferase assay of four Id-1 promoter constructs [no mutation, ATF3 mutation, Smad [SBM1]/first one of three loci mutations, and double (ATF3 and SBM1) mutation] in parental (nontreatment, black columns) and Ad-REIC-transduced (white columns) 211H cells. Error bars, SE. C, Western blot analysis of ATF3, pSmad3, and pSmad1 expression in Ad-LacZ–transduced or Ad-REIC–transduced 211H cells.

 
[35S]Methionine incorporation. Initially, 211H cells were transduced with 20 MOI of Ad-LacZ or Ad-REIC. Culture medium was changed to methionine (Met)–free medium at 30 h after transdcution and kept for an additional 6 h. Next, the transduced cells were pulsed with 100 Ci of [35S]Met (Met-35S-Label; ARC) for 30 min, 1 h, or 3 h, then lysed in 1% Triton-X 100, and aliquots were loaded onto 14% SDS-PAGE gels. Relative radioisotope incorporation was analyzed via X-ray film imaging.

Tissue samples. Tissues of MM were obtained from MM patients who underwent surgical operation. Control tissues were kindly provided from Eisaku Kondo (Department of Pathology, Okayama University). All samples were immediately formalin-fixed and stored for 1 wk and, thereafter, embedded in paraffin. Frozen cores were sectioned at –20°C in a cryostat. All sections (5 µm in thickness) were taken for H&E staining. We have gotten informed consent for usage of resected tissues as research materials from all patients at the time of operation and totally followed the Helsinki Declaration and institutional instructions.

3,3'-Diaminobenzidine staining. A microwave procedure was performed in a 10 mmol/L citric acid buffer solution for 3 min at the boiling point after the sections were deparaffinized and rehydrated. They were incubated in 0.3% hydrogen peroxide in methanol for 30 min at room temperature to block endogenous peroxidase activity. Sections were incubated with an individual antibody diluted in TBS for 24 h at 4°C, and this was followed by EnVision/HRP (Dako). The sections were reacted by 0.02% 3,3'-diaminobenzidine (DAB; Sigma) with 0.006% hydrogen peroxide in 0.05 mol/L Tris-HCl (pH 7.6) and were counterstained slightly with Mayer's hematoxylin. They were mounted with Entellan New (Merck Ltd.). The intensity of those stains was observed under a light microscope.

In vivo experiments. 211H cells/Luc (2.0 x 106 in 100 µL PBS) were injected into the right pleural cavity of 8-wk-old BALB/C nude mice (SLC). One week after injection, after screening available mice by IVIS system, 4.0 x 108 plaque-forming units of Ad-REIC or Ad-LacZ in a 100-µL PBS buffer were injected from same spot where cells were injected. The same volume of just PBS was also injected as a negative control. The light of emission in each mouse was measured by IVIS system (photon/s) every 5 d over 20 d after the injection, followed by monitoring those survivals until every mouse died. The size and the number of tumor were evaluated at 10 d in another Ad-REIC, Ad-LacZ, and PBS-treated groups. The animal experiments were done according to a guideline determined in our university.

Isolation of tissue RNA and protein. The orthotopic tumor tissue was collected at day 10 after Ad-REIC, Ad-lacZ, or PBS injection and cut into two pieces. One was used for RNA extraction and the other for protein extraction. Total RNA was extracted from tumor samples according to the protocol of the TRIzol (Invitrogen). The amount of RNA was measured spectrophotometrically by the absorbance at 260 nm. One microgram of RNA was incubated for 15 min at room temperature with DNase I (1 unit/µg; Invitrogen), followed by thermal inactivation of the enzyme (65°C for 10 min) in the presence of 2.5 mmol/L EDTA and a rapid cooling down to 4°C. The purity of the RNA was estimated by the ratio of the absorbance at 260/280 (A260/280). The RNA was stored at –80°C until use. For protein extraction, obtained tissue was frozen on dry ice immediately. For the processing of the tissue, it was thawed on ice, minced, and homogenized in lysis buffer (T-PER Tissue Protein Extraction Reagent and complete protease inhibitor cocktail, Roche). The homogenates were then centrifuged at 10,000 x g for 15 min at 4°C to pellet cellular debris, and total protein concentration was determined by Bradford method using bovine serum albumin for generating standard curve.

Real-time PCR. Real-time PCR was performed using RT-PCR kit (Applied Biosystems) with following sets of primers: Id-1(human)-forward/TagMan/reverse, tgaggcactggcgagga/agggcgctcctctctgcacacct/caccccctaaagtctctggtga; β-actin-forward/TagMan/reverse, cctttttgtcccccaacttga/atgtatgaaggcttttggtctccctggga/tggctgcctccaccca. The relative level of the gene of interest was calculated from the threshold cycle (CT) using the following equation: 2{Delta}Ct; {Delta}Ct = CT(Id-1 gene) – CT(β-actin). β-Actin was used as endogenous control. All samples were run in triplicate, and for each run, three no template control samples were included. For all the RT steps, controls with no RT enzyme were performed. All experiments were done thrice independently. The data present are representative of one.

Statistical analysis. Statistically significant differences in most experiments were determined by Student's t test. Significance of correlation of lighting emission between Ad-REIC–treated and Ad-lacZ–treated groups was calculated using Mann-Whitney's U test. Survival rates are presented as Kaplan-Maier curves, and significance was calculated by the log-rank test. Error bars represent SE. *P < 0.05 was considered to be significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Ad-REIC transduction provokes apoptosis through JNK phosphorylation in 211H cells. Our previous study showed that REIC/Dkk-3–induced apoptosis in prostate cancer cells was JNK-dependent (4). As shown in Fig. 1A , 211H cells (immortalized MM cells) also underwent apoptosis in response to overexpression of REIC/Dkk-3. Western blot analysis showed that the active (cleaved) form of caspase-3 was increased after JNK/c-Jun phosphorylation (Fig. 1B). As anticipated, use of a JNK inhibitor significantly decreased the number of apoptotic cells induced by Ad-REIC transduction (Fig. 1C, lane 3 Ad-REIC and lane 4 Ad-REIC with JNK inhibitor). These results strongly suggested that REIC/Dkk-3–induced apoptosis in immortalized MM cells was largely dependent on activation of JNK.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. REIC/Dkk-3–induced apoptosis in 211H cells was JNK-dependent. A, Tunnel assay in REIC/Dkk-3 adenovirus (Ad-REIC)–transduced 211H cells. B, Western blot analysis of the expression of apoptosis-related proteins in Ad-REIC–transduced 211H cells. C, percentage of apoptotic 211H cells transduced with Ad-REIC. The apoptotic percentage was calculated as the number of GFP-positive nuclei (top) per 100 4',6-diamidino-2-phenylindole (DAPI)–positive nuclei (bottom). JNK inhibitor was added into the culture medium 6 h after transduction. Error bars, SE.

 
In addition, we detected reduced expression of Bcl-2 and Bcl-xL, as well as translocation of Bax into the mitochondria. No change in β-catenin localization in Ad-REIC–transduced 211H cells was observed (data not shown). Those findings are consistent with the ones of our previous report (4).

Down-regulation of Id-1 was crucially involved in Ad-REIC–induced apoptosis. Subsequently, to elucidate molecular events regulating JNK phosphorylation in REIC/Dkk-3–induced apoptosis, we focused on the expression of Id-1. Id-1 is involved in the tumor biology of numerous cancers and is known to promote cell proliferation and invasion and to confer antiapoptotic properties (7). Interestingly, decreased expression of Id-1 at both the protein and transcription level was observed in Ad-REIC–transduced 211H cells (Fig. 2A and B ). Next, we examined the effects of decreased expression of Id-1 on REIC/Dkk-3–induced apoptosis and found that restoration of Id-1 expression by Id-1 adenovirus (Ad-Id-1) transduction antagonized REIC/Dkk-3–induced apoptosis by ~70% (Fig. 2C). Moreover, phosphorylation of JNK and c-Jun, as well as activation of caspase-3, was also suppressed by Id-1 reexpression (Fig. 2D). These findings suggested that decreased expression of Id-1 was crucially responsible for JNK phosphorylation in 211H cells transduced with Ad-REIC.


Figure 2
View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Transcriptional down-regulation of Id-1 exerted considerable effects on REIC/Dkk-3–induced apoptosis. A, Western blot analysis of Id-1 expression in 211H cells transduced with Ad-REIC. B, RT-PCR analysis of Id-1 expression in 211H cells transduced with Ad-REIC. C, percentage of apoptotic 211H cells cotransduced with Ad-REIC and Ad-Id-1. Ad-Id-1 (10 MOI), but not Ad-lacZ (10 MOI) cotransduction, antagonized Ad-REIC (20 MOI)–induced apoptosis. Top, Western blot of Id-1 in 211H cells examined. Error bars, SE. D, Western blot analysis of apoptosis-related proteins in 211H cells cotransduced with Ad-REIC and Ad-Id-1.

 
ATF3 and Smad are likely candidate molecules responsible for the suppression of Id-1 promoter activity by Ad-REIC transduction. Our next question is how REIC/Dkk-3 affects expression of Id-1 at the transcriptional level. Thus far, several transcription factors, including YY1, Egr1, ATF3/CREB, and Smad, have been shown to negatively regulate Id-1 expression (1821). To confirm which transcription factors are responsible for the decreased expression of Id-1 in Ad-REIC–transduced cells, we created mutations in the binding motif sequences of YY1, Egr-1, ATF3/CREB, and Smad (at respective three loci) and ATF3 and Smad (first of the three loci) double mutations (mutation c with d) in the human 2.1 kbp Id-1 promoter (Fig. 3A ). As shown in Fig. 3B, overexpression of REIC/Dkk-3 decreased the nonmutated Id-1 promoter activity (lane block 1), but not the double (ATF3 and Smad)–mutated promoter activity (lane block 4), compared with respective control (nontreatment) condition, suggesting that ATF3 and/or Smad may be responsible for REIC/Dkk-3–mediated suppression of Id-1 promoter activity. Conversely, the lack of a binding motif for either ATF3 or Smad was not enough to diminish REIC/Dkk-3–mediated suppression of Id-1 promoter activity (lane blocks 2 and 3). These results strongly suggest that both ATF3 and Smad might be essential for REIC/Dkk-3–mediated suppression of Id-1 promoter activity. Furthermore, Western blot analysis revealed that expression of ATF3 and phosphorylated Smad3 (pSmad3) were enhanced in Ad-REIC–transduced cells compared with Ad-LacZ–transduced cells (Fig. 3C), supporting crucial involvement of ATF3 and Smad in REIC/Dkk-3–mediated alteration of Id-1 promoter activity. Thus, we concluded that forced expression of REIC/Dkk-3 regulated the transcription of the Id-1 gene by activating ATF3 and Smad3. No other mutations substantially affected Id-1 promoter activity after Ad-REIC transduction (data not shown).

Endoplasmic reticulum stress was evoked by Ad-REIC transduction and activated ATF3. Because REIC/Dkk-3 is a glycosylated, secreted protein, overexpression of REIC/Dkk-3 can provoke endoplasmic reticulum (ER) stress. It is also likely that forced expression of another tumor suppressor gene, interleukin-24 (IL-24), can lead to ER stress (22). As shown in Fig. 4A , Western blot analysis revealed increased expression of several ER stress marker molecules, such as Bip, CHOP/GADD153, phosphorylated IRE1{alpha}, and phosphorylated eIF2{alpha} in Ad-REIC–transduced cells. Subsequently, to characterize ER stress functionally, we evaluated relative protein synthesis levels, which can be regulated by the PERK-eIF2{alpha} pathway in Ad-REIC–transduced cells by [35S]methionine incorporation. We found that the relative protein synthesis levels were obviously decreased in Ad-REIC–transduced cells compared with control cells (Fig. 4B). These results indicated that overexpression of REIC/Dkk-3 provoked ER stress and drove the unfolding protein response (UPR). Interestingly, we found that treatment with TPG, an ER stress inducer, reduced expression of Id-1 in a dose-dependent manner (Fig. 4C). Furthermore, TPG-mediated suppression of Id-1 promoter activity was almost completely eliminated in the ATF3-mutated promoter but not in the Smad-mutated promoter (Fig. 4D), and TPG treatment up-regulated the expression of ATF3 in 211H cells (Fig. 4D, top). Thus, activation of ATF3 by overexpression of REIC/Dkk-3, which resulted in the down-regulated expression of Id-1, was probably due to ER stress. Phosphorylation of Smad can be attributed to the intrinsic molecular properties of REIC/Dkk-3.


Figure 4
View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Activation of ATF3 was due to ER stress. A, Western blot analysis of the expression of several ER stress markers in Ad-REIC–transduced 211H cells. B, analysis of protein synthesis in Ad-REIC transduced 211H cells. Relative protein synthesis was evaluated by radiolabeled [35S]methionine incorporation. Data shown are for 30 min incubation of [35S]methionine. The numbers present correspond to molecular weight. C, Western blot analysis of Id-1 expression in thapsigargin (TPG)–treated 211H cells. D, luciferase assay of four Id-1 promoter constructs in parental (nontreatment) and TPG-treated 211H cells. Error bars, SE. Western blot shows overexpression of ATF3 in the latter cells.

 
In addition, we investigated how PERK knockdown affected REIC/Dkk-3–induced apoptosis because, in general, the PERK-eIF2{alpha} pathway not only negatively regulates protein synthesis but also leads to apoptotic induction through up-regulation of its downstream molecules, such as CHOP in the UPR. PERK down-regulation by small interfering RNA transfection led to some, not significant reduction of Ad-REIC–induced apoptosis (Supplementary Fig. S2A), indicating that a PERK-related molecular pathway (a JNK-ndependent pathway) was partly involved in REIC/Dkk-3–induced apoptosis. As shown in Fig. 1C, the JNK pathway, which has been shown to be mainly regulated by Id-1 expression (and possibly also by IRE1{alpha}), should dominantly control REIC/Dkk-3–induced apoptosis.

Reduced expression of REIC/Dkk-3 in human MM tissues. Finally, to investigate a potential application of REIC/Dkk-3 gene transfer for MM, we first examined REIC/Dkk-3 expression in human MM cross-sections and four immortalized MM cell lines by DAB staining and Western blot, respectively. As expected, the expression of REIC/Dkk-3 was significantly reduced in MM tissues (Fig. 5A ) compared with control pleural tissue derived from patients with pneumothorax. In 35 MM samples examined, 31 cases (89%) were negative for REIC/Dkk-3 expression (Fig. 5B). In contrast, we found overexpression of Id-1 in the same cross-sectional MM samples (Supplementary Fig. S2B). Moreover, none of the four MM cell lines revealed detectable level of REIC/Dkk-3 expression, but all of them expressed Id-1 (Fig. 5C). These results indicated not only a potential application of REIC/Dkk-3 gene therapy for MM but also a possible involvement of Id-1 in the tumor biology of MM.


Figure 5
View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Reduced expression of REIC/Dkk-3 was revealed in human MM clinical tissue samples. A, REIC/Dkk-3 expression analysis in human MM cross-sections by DAB staining. Left top, DAB staining of control pleural tissue obtained from a pneumothorax patient. Black arrows, REIC/Dkk-3–positive visceral pleura. Left bottom, H&E staining of serial cross-section. Other panels, DAB staining of MM cross-sections obtained from three different patients. B, degree and frequency of REIC/Dkk-3 expression in human MM tissue samples. The percentage of positive-stained tumor cells in a field was calculated and categorized into three groups: (–), 0-10% positive; (+), 10-30%; (++), 30-70%; and (+++), >70%. C, Western blot analysis of REIC/Dkk-3 and Id-1 expression in four MM immortalized cell lines (211H, H28, H2052, and H2452). OUMS-24 (human fibroblast) cells were used as positive controls expressing REIC/Dkk-3. HeLa cells were used as negative controls.

 
Of the four MM cell lines examined, we used 211H cells, a biphasic MM immortalized cell line, in subsequent experiments, because they were efficiently transduced with adenovirus and successfully formed nodular and disseminated tumors on both the visceral (Supplementary Fig. S2C, top) and parietal pleura in nude mice (Supplementary Fig. S2D; see Ad-LacZ mice).

REIC/Dkk-3 gene transfer into pleural cavity reduced tumor volume and improved survival rate in an MM orthotopic mice model. At last, we investigated the therapeutic potential of REIC/Dkk-3 gene transfer for MM using an orthotopic MM mouse model. As shown in Fig. 6A , a significant reduction in emission, as monitored by IVIS200, was detected in the Ad-REIC–treated group compared with the control group, indicating that Ad-REIC injection successfully reduced tumor volume. In addition, an increased number of apoptotic cells in Ad-REIC–treated tumors compared with control tumors were revealed by tissue Tunnel assay (1.5% versus 16.4%; Fig. 6B). Furthermore, we examined the expression of Id-1 at the mRNA level and pJNK at the protein level by real-time PCR and Western blot, respectively. Consistent with in vitro mechanistic studies, decreased expression of Id-1, as well as increased expression of pJNK, could be shown in Ad-REIC–treated tumor tissue (Fig. 6C). These data suggested that in vivo gene transfer of REIC/Dkk-3 might exert anticancer effects, at least partially, through down-regulation of Id-1, as shown by in vitro experiments. Finally, a significantly improved survival rate compared with control groups was shown (Fig. 6D). Focal migration and infiltration of inflammatory lymphocytes beneath the pleura was also detected (data not shown). However, no systemic side effects, such as severe liver injury, occurred. These findings showed the potential utility of REIC/Dkk-3 gene therapy in the treatment of MM disease.


Figure 6
View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Gene transfer of REIC/Dkk-3 in an MM orthotopic mouse model showed strong antitumor effects. A, IVIS image of representative Ad-REIC–treated or Ad-LacZ–treated MM orthotopic mice and quantitative analysis of the lighting emission. Five mice of each group were analyzed. Bar graphs show significantly decreased emission from Ad-REIC–treated MM mice (day 10) compared with control. Western blot shows clear transgene (REIC/Dkk-3 or LacZ) expression in Ad-REIC–treated and Ad-LacZ–treated orthotopic tumors. B, percentage of apoptotic cells in tumor tissue treated with Ad-LacZ or Ad-REIC and the representative tumor tissue Tunnel staining. Tunnel-positive nuclei are identified as GFP positive. The apoptotic percentage was calculated as the number of GFP-positive nuclei (top) per 100 DAPI-positive nuclei (bottom). The percentage of apoptotic cells was 1.5 and 16.4 in Ad-lacZ–treated and Ad-REIC–treated tumor tissue, respectively. Error bars, SE. C, real-time quantitative Id-1 gene expression and Western blot analysis of pJNK in Ad-REIC–treated tumors. Real-time PCR data are normalized to β-actin and presented as fold change over the nontreated control based on {Delta}Ct calculation. Error bars, SE. D, survival curves for Ad-REIC–treated, Ad-LacZ–treated, and PBS-treated mice with MM.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
In our previous study, we suggested that REIC/Dkk-3–induced apoptosis was JNK-dependent (4). However, the precise mechanisms, especially molecular mechanisms regulating JNK phosphorylation, remained unclear. Here, we showed that both ATF3 and Smad were crucially and synergistically involved in the down-regulation of Id-1, which largely committed JNK phosphorylation and played a major role in REIC/Dkk-3–induced apoptosis in an MM cell line, 211H cells. Furthermore, we suggested that ATF3 was activated by ER stress whereas phosphorylation of Smad3 could be promoted by intrinsic molecular properties of REIC/Dkk-3. This molecular mechanism was also shown to contribute to REIC/Dkk-3–induced apoptosis in other MM cell lines (Supplementary Fig. S1B and C), indicating that this type of mechanism can be generalized in REIC/Dkk-3–induced apoptosis. Thus, this study provided a better understanding of the anticancer molecular mechanism of REIC/Dkk-3 in the context of MM.

In Id-1 down-regulation, Smad activation was assumed to be a molecular event attributable to the intrinsic molecular properties of REIC/Dkk-3. A recent report suggested that REIC/Dkk-3 was essential for transforming growth factor-β (TGF-β) signaling during Xenopus mesoderm induction (23). However, no study directly showed the involvement of REIC/Dkk-3 in the TGF-β signaling pathway in mammalian cells. Direct mutagenesis experiments showed that binding of Smad to its unique binding motif was essential for the suppression of Id-1 promoter activity exerted by overexpression of REIC/Dkk-3. Furthermore, Western blot revealed enhanced expression of phosphorylated Smad3 in Ad-REIC–transduced cells (Fig. 3C). Phosphorylated Smad1 expression levels did not differ among the samples examined, indicating little activation of bone morphogenetic protein signaling in Ad-REIC–transduced cells. Thus, initially, we suggested that REIC/Dkk-3 might mediate activity of the TGF-β signal transduction pathway in mammalian cells, as well. The question as to how overexpression of REIC/Dkk-3 led to Smad phosphorylation remains unclear. Pinho and colleagues speculated that REIC/Dkk-3 can act in a permissive manner in TGF-β signaling during Xenopus mesoderm induction, indicating that, whereas its overexpression has little effect, loss of its function results in inactivation of TGF-β receptors. Our results suggest that overexpression of REIC/Dkk-3 may activate TGF-β receptor, leading to Smad phosphorylation. Whether in a permissive or active manner, REIC/Dkk-3 regulation of the TGF-β signal at the receptor level may be attributed to differences in species or experimental design. Thus, a more specific study investigating TGF-β receptor activation will provide further evidence for the identification of REIC/Dkk-3 receptor.

This study reported that ER stress was evoked by forced expression of REIC/Dkk-3 and activated ATF3 (Fig. 4A and B), leading to Id-1 down-regulation. These findings are consistent with two other studies reporting on the down-regulation of Id-1 by ATF3 (18) and the induction of Id-1 down-regulation by ER stress (20). ER stress can be evoked and plays a role in the induction of apoptosis when particular glycosylated proteins are overexpressed. For example, overexpression of IL-24, a tumor suppressor gene, effectively evokes ER stress, which promotes IL-24–induced apoptosis in cancer cells (22). ER stress relevant to overexpression of IL-24 presumably results from interactions between IL-24 and specific target molecules (still unknown) in the ER of cancer cells, which elicit an UPR, thereby promoting cancer cell apoptosis (22). We have speculated that REIC/Dkk-3 can also efficiently evoke ER stress via a mechanism similar to that presumed in IL-24–evoked ER stress because even low MOI of Ad-REIC could likely evoke ER stress (Supplementary Fig. S1A). In addition, this experiment ruled out the possibility that only extremely high, rather than moderate, overexpression of REIC/Dkk-3 can lead to apoptosis in 211H cells. Thus, in this study, we successfully showed that ER stress definitely participated in the mechanism of REIC/Dkk-3–induced apoptosis.

The question as to how down-regulation of Id-1 contributes to activation of JNK remains unclear. Zhang and colleagues showed that, through partial promotion of JNK phosphorylation, down-regulation of Id-1 induced apoptosis of prostate cancer cells by improving their sensitization to the anticancer drug Taxol (10). However, the detailed mechanism of interaction between Id-1 and JNK was not clarified in the report. One key molecule that may be involved in this mechanism is NF-{kappa}B. The tumor protective role of Id-1 stems from its ability to transcriptionally activate the NF-{kappa}B pathway, which regulates the expression of downstream factors, such as intercellular adhesion molecule-1 and Bcl-xl (13). Interestingly, it has been reported that NF-{kappa}B negatively regulates JNK activation in TNF-{alpha}–induced apoptosis (24). Thus, it is possible that the NF-{kappa}B pathway plays a role in Id-1–mediated JNK inactivation. Further studies focusing on NF-{kappa}B will provide clues to elucidate the detailed mechanism underlying the interaction between Id-1 and JNK.

Gene therapy could be used for treatment of MM, because MM tumors located in the pleural cavity are accessible to in vivo gene delivery. Several phase I/phase II clinical trials of gene therapy for MM have been carried out using various genes (HSVtk combined with ganciclovir, IL-2, and IFN-β) and have shown gene transduction or T-cell infiltration in tumors injected with therapeutic vectors (25). However, these trials also highlighted the need for further optimization of such treatment regimens and more potent therapeutic genes. Here, we showed that a single injection of Ad-REIC provided strong antitumor effects without any systemic side effects in an MM orthotopic mouse model. As shown in Supplementary Fig. S2D, orthotopic tumors in Ad-REIC–treated mice mostly disappeared at day 10 after Ad-REIC injection, although gene transduction was not completely achieved in all cells of orthotopic tumors (Supplementary Fig. S2C, bottom), suggesting a bystander effect of the REIC/Dkk-3 gene transfer. Although the underlying mechanisms remain unclear, our data endorse a therapeutic potential for REIC/Dkk-3 gene transfer for MM. Therefore, this strategy could serve as an alternative to conventional ones in gene therapy for MM.

Moreover, this study provides new pathogenic findings for MM. About 90% of the tissue samples examined showed decreased expression of REIC/Dkk-3, suggesting that loss of REIC/Dkk-3 expression contributes to the carcinogenesis or metastasis of MM, as it does in other cancers. In contrast, we found overexpression of Id-1 in the same cross-sectional MM samples (Supplementary Fig. S2B). In general, the Id family plays important roles in cell proliferation and tumor biology (antiapoptosis, angiogenesis, effects on invasion, and other effects) in various cancers (7). Moreover, overexpression of Id-1 has been reported in over 20 types of cancers, including cervical, prostate, and breast cancers, and is thought to play important roles in carcinogenesis and metastasis (7). Thus, overexpression of Id-1 in MM tissue samples in our DAB staining experiments indicate probable pathogenic involvement of Id-1 in MM, as well. Interestingly, forced expression of REIC/Dkk-3 down-regulated Id-1 expression in several MM cell lines examined. This down-regulation was mainly responsible for REIC/Dkk-3–induced apoptosis. The capacity to down-regulate Id-1 might indicate its utility in wide application of REIC/Dkk-3 gene therapy for numerous types of cancers. In clinical use, pathologic examination of Id-1 expression, as well as that of REIC/Dkk-3, may be useful for predicting the efficacy of REIC/Dkk-3 gene therapy.

In brief, we showed that down-regulation of Id-1 via activation of ATF3 and Smad was crucially involved in REIC/Dkk-3–induced apoptosis and elucidated strong antitumor effects from REIC/Dkk-3 gene transfer in an MM orthotopic mouse model. This study, thus, provides a better understanding of the anticancer molecular mechanisms of REIC/Dkk-3 and highlighted REIC/Dkk-3 gene therapy as a promising therapeutic tool for MM.


    Disclosure of Potential Conflicts of Interest
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
No potential conflicts of interest were disclosed.


    Acknowledgments
 
Grant support: Special Coordination Funds for Promoting Science and Technology (Formation of Innovation Center for Fusion of Advanced Technologies) from Japan Ministry of Education, Culture, Sports, Science, and Technology.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Prof. Hiroshi Date (Okayama University, Department of Cancer and Thoracic Surgery) and Dr. Takumi Kishimoto (Internal Medicine, Okayama Rosai Hospital) for providing the MM tissues and Katsuo Ohno, Hideo Ueki, and Shun-Ai Li for their technical assistance.

Received 1/ 9/08. Revised 5/14/08. Accepted 6/17/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Mao B, Wu W, Li Y, et al. LDL-receptor-related protein 6 is a receptor for Dickkopf proteins. Nature 2001;411:321–5.[CrossRef][Medline]
  2. Niehrs C. Function and biological roles of the Dickkopf family of Wnt modulators. Oncogene 2006;25:7469–81.[CrossRef][Medline]
  3. Tsuji T, Nozaki I, Miyazaki M, et al. Antiproliferative activity of REIC/Dkk-3 and its significant down-regulation in non-small-cell lung carcinomas. Biochem Biophys Res Commun 2001;289:257–63.[CrossRef][Medline]
  4. Abarzua F, Sakaguchi M, Takaishi M, et al. Adenovirus-mediated overexpression of REIC/Dkk-3 selectively induces apoptosis in human prostate cancer cells through activation of c-Jun-NH2-kinase. Cancer Res 2005;65:9617–22.[Abstract/Free Full Text]
  5. Ling MT, Wang X, Zhang X, Wong YC. The multiple roles of Id-1 in cancer progression. Differentiation 2006;74:481–7.[CrossRef][Medline]
  6. Wong YC, Wang X, Ling MT. Id-1 expression and cell survival. Apoptosis 2004;9:279–89.[CrossRef][Medline]
  7. Ruzinova MB, Benezra R. Id proteins in development, cell cycle and cancer. Trends Cell Biol 2003;13:410–8.[CrossRef][Medline]
  8. Li B, Cheung PY, Wang X, et al. Id-1 activation of PI3K/Akt/NF{kappa}B signaling pathway and its significance in promoting survival of esophageal cancer cells. Carcinogenesis 2007;28:2313–20.[Abstract/Free Full Text]
  9. Lin JC, Chang SY, Hsieh DS, Lee CF, Yu DS. Modulation of mitogen-activated protein kinase cascades by differentiation-1 protein: acquired drug resistance of hormone independent prostate cancer cells. J Urol 2005;174:2022–6.[CrossRef][Medline]
  10. Zhang X, Ling MT, Wang X, Wong YC. Inactivation of Id-1 in prostate cancer cells: a potential therapeutic target in inducing chemosensitization to Taxol through activation of JNK pathway. Int J Cancer 2006;118:2072–81.[CrossRef][Medline]
  11. Cheung HW, Ling MT, Tsao SW, Wong YC, Wang X. Id-1-induced Raf/MEK pathway activation is essential for its protective role against Taxol-induced apoptosis in nasopharyngeal carcinoma cells. Carcinogenesis 2004;25:881–7.[Abstract/Free Full Text]
  12. Zhang X, Ling MT, Wang Q, et al. Identification of a novel inhibitor of differentiation-1 (ID-1) binding partner, caveolin-1, and its role in epithelial-mesenchymal transition and resistance to apoptosis in prostate cancer cells. J Biol Chem 2007;282:33284–94.[Abstract/Free Full Text]
  13. Ling MT, Wang X, Ouyang XS, Xu K, Tsao SW, Wong YC. Id-1 expression promotes cell survival through activation of NF-{kappa}B signalling pathway in prostate cancer cells. Oncogene 2003;22:4498–508.[CrossRef][Medline]
  14. Robinson BW, Lake RA. Advances in malignant mesothelioma. N Engl J Med 2005;353:1591–603.[Free Full Text]
  15. Tsiouris A, Walesby RK. Malignant pleural mesothelioma: current concepts in treatment. Nat Clin Pract Oncol 2007;4:344–52.[CrossRef][Medline]
  16. Kashiwakura Y, Katoh Y, Tamayose K, et al. Isolation of bone marrow stromal cell-derived smooth muscle cells by a human SM22{alpha} promoter: in vitro differentiation of putative smooth muscle progenitor cells of bone marrow. Circulation 2003;107:2078–81.[Abstract/Free Full Text]
  17. Katagiri T, Imada M, Yanai T, Suda T, Takahashi N, Kamijo R. Identification of a BMP-responsive element in Id1, the gene for inhibition of myogenesis. Genes Cells 2002;7:949–60.[Abstract]
  18. Kang Y, Chen CR, Massague JA. self-enabling TGFβ response coupled to stress signaling: Smad engages stress response factor ATF3 for Id1 repression in epithelial cells. Mol Cell 2003;11:915–26.[CrossRef][Medline]
  19. Kurisaki K, Kurisaki A, Valcourt U, et al. Nuclear factor YY1 inhibits transforming growth factor β- and bone morphogenetic protein-induced cell differentiation. Mol Cell Biol 2003;30:519–23.
  20. Nemetski SM, Gardner LB. Hypoxic regulation of Id-1 and activation of the unfolded protein response are aberrant in neuroblastoma. J Biol Chem 2007;282:240–8.[Abstract/Free Full Text]
  21. Tournay O, Benezra R. Transcription of the dominant-negative helix-loop-helix protein Id1 is regulated by a protein complex containing the immediate-early response gene Egr-1. Mol Cell Biol 1996;16:2418–30.[Abstract]
  22. Sieger KA, Mhashilkar AM, Stewart A, et al. The tumor suppressor activity of MDA-7/IL-24 is mediated by intracellular protein expression in NSCLC cells. Mol Ther 2004;9:355–67.[Medline]
  23. Pinho S, Neihrs C. Dkk3 is required for TGF-β signaling during Xenopus mesoderm induction. Differentiation 2007;75:957–67.[Medline]
  24. Tang G, Minemoto Y, Dibling B, et al. Inhibition of JNK activation through NF-{kappa}B target genes. Nature 2001;414:313–7.[CrossRef][Medline]
  25. van der Most RG, Robinson BW, Nelson DJ. Gene therapy for malignant mesothelioma: beyond the infant years. Cancer Gene Ther 2006;13:897–904.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
H. Hirata, Y. Hinoda, K. Nakajima, K. Kawamoto, N. Kikuno, K. Kawakami, S. Yamamura, K. Ueno, S. Majid, S. Saini, et al.
Wnt Antagonist Gene DKK2 Is Epigenetically Silenced and Inhibits Renal Cancer Progression through Apoptotic and Cell Cycle Pathways
Clin. Cancer Res., September 15, 2009; 15(18): 5678 - 5687.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Sakaguchi, K. Kataoka, F. Abarzua, R. Tanimoto, M. Watanabe, H. Murata, S. S. Than, K. Kurose, Y. Kashiwakura, K. Ochiai, et al.
Overexpression of REIC/Dkk-3 in Normal Fibroblasts Suppresses Tumor Growth via Induction of Interleukin-7
J. Biol. Chem., May 22, 2009; 284(21): 14236 - 14244.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kashiwakura, Y.
Right arrow Articles by Kumon, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kashiwakura, Y.
Right arrow Articles by Kumon, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online