Cancer Research Cancer Epigenetics Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 68, 8889, November 1, 2008. doi: 10.1158/0008-5472.CAN-08-2147
© 2008 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jinushi, M.
Right arrow Articles by Dranoff, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jinushi, M.
Right arrow Articles by Dranoff, G.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Milk Fat Globule EGF-8 Promotes Melanoma Progression through Coordinated Akt and Twist Signaling in the Tumor Microenvironment

Masahisa Jinushi1,4, Yukoh Nakazaki1, Daniel R. Carrasco1,2, Dobrin Draganov1, Nicholas Souders1, Matthew Johnson3, Martin C. Mihm3 and Glenn Dranoff1

1 Department of Medical Oncology and Cancer Vaccine Center, Dana-Farber Cancer Institute and Department of Medicine, Brigham and Women's Hospital and Harvard Medical School; 2 Department of Pathology, Brigham and Women's Hospital and Harvard Medical School; 3 Department of Pathology, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts and 4 Department of Bioengineering, Advanced Clinical Research Center, Institute of Medical Science, University of Tokyo, Tokyo, Japan

Requests for reprints: Glenn Dranoff, Dana-Farber Cancer Institute, Dana 520C, 44 Binney Street, Boston, MA 02115. Phone: 617-632-5051; Fax: 617-632-5167; E-mail: glenn_dranoff{at}dfci.harvard.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
The pathogenesis of malignant melanoma involves the interplay of tumor cells with normal host elements, but the underlying mechanisms are incompletely understood. Here, we show that milk fat globule EGF-8 (MFG-E8), a secreted protein expressed at high levels in the vertical growth phase of melanoma, promotes disease progression through coordinated {alpha}vβ3 integrin signaling in the tumor microenvironment. In a murine model of melanoma, MFG-E8 enhanced tumorigenicity and metastatic capacity through Akt-dependent and Twist-dependent pathways. MFG-E8 augmented melanoma cell resistance to apoptosis, triggered an epithelial-to-mesenchymal transition (EMT), and stimulated invasion and immune suppression. In human melanoma cells, MFG-E8 knockdown attenuated Akt and Twist signaling and thereby compromised tumor cell survival, EMT, and invasive ability. MFG-E8–deficient human melanoma cells also showed increased sensitivity to small molecule inhibitors of insulin-like growth factor I receptor and c-Met. Together, these findings delineate pleiotropic roles for MFG-E8 in the tumor microenvironment and raise the possibility that systemic MFG-E8 blockade might prove therapeutic for melanoma patients. [Cancer Res 2008;68(21):8889–98]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
The initiation and progression of cancer involves multiple interactions between transformed cells and normal host elements (1). Whereas cytotoxic lymphocytes may prevent or impede tumor growth in some cases, unresolved inflammation is a common and potent tumor promoter (2, 3). Early during carcinogenesis, innate immune cells, including macrophages, granulocytes, and mast cells, provide signals that regulate tumor cell growth and differentiation, whereas in later disease stages, stromal cell–derived cues foster angiogenesis, invasion, and metastasis (4, 5). These diverse pathogenic mechanisms are regulated in part by the mixture of soluble factors present in the tumor microenvironment. In particular, inflammatory cytokines, such as tumor necrosis factor-{alpha}, interleukin-6 (IL-6), and IL-1β, fuel disease progression through the activation of nuclear factor-{kappa}B (NF-{kappa}B), signal transducers and activators of transcription-3 (STAT-3), and MyD88-dependent pathways (6–9).

Granulocyte macrophage colony-stimulating factor (GM-CSF) is another cytokine frequently produced in the tumor microenvironment, but its precise role in carcinogenesis remains to be clarified fully. Vaccination with irradiated tumor cells engineered to secrete GM-CSF engenders protective immunity through improved tumor antigen presentation by dendritic cells and macrophages (10). Clinical testing of this vaccination scheme in patients with advanced solid and hematologic malignancies showed the consistent induction of intratumoral T-cell and B-cell infiltrates that effectuated extensive necrosis (11, 12). Further tumor destruction was accomplished through the subsequent administration of blocking antibodies to CTL-associated antigen-4 (13). Notwithstanding these therapeutic activities, tonic GM-CSF production in the tumor microenvironment is typically associated with disease progression, which may reflect in part the stimulation of myeloid suppressor cells that attenuate cytotoxic lymphocyte function (14–17).

Through an analysis of GM-CSF–deficient mice and irradiated GM-CSF–secreting tumor cell vaccines, we recently identified milk fat globule EGF-8 (MFG-E8) as a major determinant of GM-CSF function (18). MFG-E8 is a secreted phosphatidylserine binding protein that engages {alpha}vβ3 and {alpha}vβ5 integrins (19, 20). Under steady-state conditions, GM-CSF triggers MFG-E8 expression in macrophages and dendritic cells, resulting in the efficient phagocytosis of apoptotic cells, the maintenance of FoxP3+ regulatory T cells (Treg), and the suppression of autoreactive Th1 and Th17 cells (18). However, under conditions of stress, Toll-like receptor agonists or necrotic cells down-regulate MFG-E8 levels, wherein GM-CSF evokes protective responses through an MFG-E8–independent mechanism. Together, these findings raise the possibility that the presence of MFG-E8 in the tumor microenvironment might skew GM-CSF activity toward disease promotion rather than inhibition. Consistent with this idea, we previously reported that infiltrating myeloid cells in diverse human cancers display strong MFG-E8 staining by immunohistochemistry (18).

In malignant melanoma, progression to the vertical growth phase is linked with the acquisition of competence for tumor cell invasion and distant dissemination (21, 22). In model systems, the enforced activation of Akt is sufficient to transform melanocytic lesions from the radial to the vertical growth phase (23). Clinicopathologic investigations delineated up-regulation of {alpha}vβ3 integrin expression on melanoma cells as the most consistent histologic marker for this stage of disease (24, 25). Melanoma cells thereby manifest an increased resistance to apoptosis and an epithelial-to-mesenchymal transition (EMT), with down-regulation of E-cadherin and up-regulation of vimentin and N-cadherin (26–28). The enhanced release of vascular endothelial growth factor (VEGF), matrix metalloproteinase-2 (MMP-2), and MMP-9 at this stage may also stimulate angiogenesis and foster the breach of normal tissue planes (29–31). How these diverse mechanisms are orchestrated during melanoma progression, though, remains incompletely understood.

Based upon the increased expression of {alpha}vβ3 integrin on melanoma cells at the vertical growth phase and the ability of MFG-E8 to engage this receptor, we wondered whether MFG-E8 might play a role in melanoma biology. Here, we show that MFG-E8 production in tumor and infiltrating myeloid cells is associated with melanoma progression and that MFG-E8 acts as a potent tumor promoter through coordinated {alpha}vβ3 integrin signaling in the tumor microenvironment.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 References
 
Mice. C57Bl/6 wild-type and GM-CSF–deficient mice backcrossed at least nine generations onto the C57Bl/6 strain were housed under specific pathogen-free conditions (32). All the experiments were conducted under a protocol approved by the Association for Assessment and Accreditation of Laboratory Animal Care International–accredited Dana-Farber Cancer Institute and Harvard Medical School Institutional Animal Care and Use Committee.

Histology and immunohistochemistry. Human melanocytic lesions from discarded tissues were embedded in paraffin, sectioned, and stained with H&E. Tissue sections were treated for antigen retrieval with a pressure cooker for 20 min, incubated with 5 µg/mL of mouse anti-human MFG-E8 primary antibody (R&D Systems) in 3% bovine serum albumin/PBS blocking solution for 16 h at 4°C, and developed with the corresponding secondary biotinylated antibody and the streptavidin-peroxidase complex from Vector Labs. The intensity of staining was graded from 0 to 3+ as follows: 0, no staining; 1+, faint, light beige staining; 2+, easily visible staining affecting most cells with a tan coloration; 3+, strong, diffuse brown staining of the cells.

Retroviral-mediated gene transfer. Full-length sequences encoding the open reading frames of murine MFG-E8 long splice form or the RGE mutant (which replaces the RGD sequence in the second epidermal growth factor domain with RGE) were introduced into the pMFG retroviral vector, high titer VSV-G pseudotyped replication defective viral stocks prepared with 293-GPG cells and B16 cells transduced with the viruses, as previously described (18). Peritoneal macrophages were induced to replicate by culture in DME plus 10% FCS supplemented with 10 ng/mL M-CSF (R&D Systems). Viral supernatants were added to the cultured macrophages overnight in the presence of polybrene (8 µg/mL) to facilitate infection. The transduced cells were then washed and used for experiments 2 to 3 d later.

B16 melanoma model. Female C57Bl/6 mice (8–12 wk old) were injected s.c. in the flank with 2 x 105 live retrovirally transduced (GFP, MFG-E8, and/or RGE) B16 cells, and the product of tumor diameters as a function of time was determined. For the tumor metastases studies, we infused 1 x 104 live B16 cells i.v. through the tail vein and sacrificed the mice 20 d later for pathologic examination. These conditions were based on preliminary dose-response studies using varying numbers of injected melanoma cells.

Bone marrow transplantation. After 48 h of preconditioning with 5-fluorouracil (150 mg/kg), bone marrow cells were isolated from 8 to 10 wk old wild-type or GM-CSF–deficient mice and cultured overnight with X-VIVO (Cambrex) supplemented with stem cell factor (100 ng/mL) and thrombopoietin (50 ng/mL). The cells were transduced with retroviral supernatants for 48 h, and then 1 x 106 cells were injected into lethally irradiated recipients (two doses of 560 rad, 6 h apart, using a 137Cs source). Eight weeks after the transplant, mice were challenged with wild-type B16 cells s.c. as above.

Flow cytometry. Tumor infiltrates were obtained from B16 challenge sites using a Nocoprep (Axis-Shield) cell gradient separation. The cells were analyzed by flow cytometry using monoclonal antibodies (mAb) against CD3, CD4, CD11b, Gr-1, and Foxp3. For MFG-E8 staining, myeloid cells were pretreated with GolgiPlug (BD-PharMingen), stained with anti-CD11b and anti-GR1 mAb (BD-PharMingen), fixed, permeabilized with Cytofix/Cytoperm buffer (BD-PharMingen), and stained again with unconjugated MFG-E8 mAb (Alexia) followed by PE-labeled goat anti-IgG2 Ab (BD-PharMingen). For FoxP3 staining, lymphoid cells were labeled with anti-CD3 and CD4 mAbs (BD PharMingen), washed, and then stained with PE-labeled anti-FoxP3 antibody using the FoxP3 staining set according to the manufacturer's protocol (eBioscience). The frequency of each immune cell populations was determined by flow cytometry. Cell acquisition was done with a FW501 flow cytometer (Beckman-Coulter) and analyzed by FlowJo software (Tree Star).

Immunoblotting. Transduced B16 melanoma cells or wild-type B16 cells exposed to supernatants harvested from transduced macrophages were subjected to Western blotting using antibodies against MFG-E8 (MBL International), phosphorylated Akt, Akt, phosphorylated S6 kinase, S6 kinase, phosphorylated STAT-3 (Ser727), STAT-3, phosphorylated STAT-1 (Ser727; all from Cell Signaling Technology), Twist-1 (Santa Cruz Biotechnology), E-cadherin, Snail, and vimentin (BD Biosciences). β-Actin was used as a loading control to check the integrity of each sample.

Induction of apoptosis. B16 cells were treated with etoposide (10 µmol/L) or anti-Fas antibody (1 µg/mL) overnight, visualized by phase contrast microscopy, and stained with Annexin V and propidium iodide for flow cytometric analysis of cell death. Caspase-3 activity was quantified with a colorimetric assay kit according to the manufacturer's instructions (Invitrogen). In some experiments, blocking antibodies against {alpha}vβ3 integrin (clone RMV-7; Millipore) were used.

Immunofluorescence microscopy. 1 x 105 B16 cells were cultured on a glass chamber plate overnight, washed thrice to remove floating cells, and fixed with 20% methanol at –20°C for 5 min. The cells were stained with anti–E-cadherin or anti-vimentin mAbs, then AlexaFlow 488–labeled or Cy3-labeled IgG (H + L) as secondary antibodies and visualized using a TE2000-U inverted fluorescence microscope (Nikkon).

Small interfering RNA transduction. The small interfering RNA (siRNA)–coding oligos against mouse Twist-1, Akt-1, and Akt-2 were designed using BLOCK-iT RNAi Designer (Invitrogen) and verified for specificity by blast search against the mouse genome. The sequences used were MFG-E8 ACAAGACATGGAACCTGCGTGCTTT, Twist-1 AGCTGAGCAAGATTCAGACCCTCAA, Akt-1 ACGAGTTTGAGTACCTGAAACTACT, Akt-2 GAGGACCTTCCATGTAGACTCTCCA. The siRNA sequences (or control sequences that do not match any known murine cDNA) were cloned downstream of a U6 promoter in pCMMP-eGFP, the siRNA cassette was introduced into the pMFG retroviral vector, and viral stocks were prepared with 293-GPG cells and used to transduce B16 cells. Akt-1 and Akt-2 knockdowns were performed concurrently. The efficiency of gene knockdown ranged from 50% to 90%, as determined by immunoblotting.

In vitro invasion assay. The effects of MFG-E8 on tumor cell invasion were determined using the BD BioCoat Tumor Invasion Assay System (BD Bioscience) according to the manufacturer's instructions. Briefly, the upper chamber was precoated with 100 µL Matrigel, whereas serum-free media was used for the bottom chamber. 1 x 104 transduced B16 cells were seeded into the upper chamber, and 24 h later, cells that invaded into the bottom chamber were stained with 4 µg/mL Calcein AM in PBS at 37°C for 1 h and then counted with a fluorescence microscope.

Immune assays. Tumor infiltrating lymphocytes were obtained from B16 challenge sites using a Nocoprep (Axis-Shield) cell gradient separation followed by CD3+ T-cell purification with anti-CD3–labeled magnetic beads (Miltenyi). Antigen-specific CD8+ responses against H-2b restricted peptides derived from TRP-2 (180–188, SVYDFFVWL) or E1A (234–243, SGPSNTPPEI) were determined by incubating lymphocytes for 72 h with 1 x 105 B16 cells and 25 units/mL IL-2 and measuring IFN-{gamma} production by ELISPOT using peptide pulsed splenocytes as targets. Natural killer (NK) cells were isolated from spleens by fluorescence-activated cell sorting, yielding >95% pure population of NKp46+ CD3– lymphocytes. Cytotoxicity and IFN-{gamma} production were assessed against YAC-1 cells by flow cytometry. FITC-labeled CD107a mAb was added to the effector and target cell mixtures during 4 h of incubation, whereas PE-labeled anti–IFN-{gamma} was added 2 h after brefeldin A treatment. For Treg stimulation assays, thioglycollate elicited peritoneal macrophages (treated with control, MFG-E8, or Twist-1 siRNAs) were exposed to apoptotic thymocytes (induced with 10 µmol/L dexamethasone for 6 h) and cocultured with wild-type syngeneic splenocytes. FoxP3 expressing Tregs were assayed by flow cytometry.

Human melanoma cells. Human melanoma cell lines were established from patients enrolled in vaccine studies, as described (11). The antibodies used for flow cytometry and immunoblotting were MFG-E8 (R&D Systemes), FAK, Src, phosphorylated Akt, Akt, E-cadherin, N-cadherin (Cell Signaling Technology), Twist-1, and Snail (Santa Cruz Technology). The siRNA sequence for human MFG-E8 (CCTACAGCCTTAATGGACACGAATT) was designed using online design software (Invitrogen), synthesized as a double-strand oligonucleotide, cloned into the pENTRTM/U6 plasmid (Invitrogen), and then transfected into human melanoma cells. Insulin-like growth factor I (IGF-I; 10 µmol/L) receptor inhibitor (AG538) or c-Met inhibitor (SU11274; Sigma Aldrich) were applied to melanoma cells for 6 h, and cell death was determined by flow cytometry using Annexin V and propidium iodide (BD Bioscience). In vitro invasion assays were performed with Matrigel as above.

Statistics. The differences between two groups were determined with the Student's t test or the two-sample t test with Welch correction. The differences among three or more groups were determined with a one-way ANOVA.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 References
 
MFG-E8 is associated with melanoma progression in patients and mice. To characterize MFG-E8 expression as a function of melanoma progression, we performed immunohistochemistry on 5 compound melanocytic nevi and 11 vertical growth phase melanomas (Fig. 1A and Supplementary Table S1). Whereas minimal MFG-E8 was detected in normal skin, compound nevi, and the radial growth phase, strong expression was noted in the vertical growth phase of most lesions, with staining in melanoma cells and/or infiltrating myeloid cells. MFG-E8 levels were significantly higher in melanomas compared with nevi (8 of 11 versus 1 of 5, P = 0.049). MFG-E8–positive tumors included all nodular and superficial spreading types examined and an unclassified case, although no expression was observed in two acral lentiginous and one lentigo maligna melanoma. The percentage of positive cells varied from <5% to 90%, with an average of 40%. Staining intensity ranged from 2 to 3+ and was diffused in five cases, deep in two, and superficial in one.


Figure 1
View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. MFG-E8 is linked with melanoma progression in patients and mice. A, immunohistochemistry for MFG-E8 expression was performed on human melanocytic lesions (n = 16). Nl, normal skin, compound nevus; RGP, radial growth phase; VGP, vertical growth phase. Magnification, 200x for normal skin, 100x for all others. B, B16 tumors growing s.c. were processed to single cells and the infiltrates stained for CD11b, Gr-1, and MFG-E8. Spleens are shown for comparison. C, C57Bl/6 mice were injected s.c. with 2 x 105 B16-GFP, B16-MFG-E8, or B16-RGE cells (four per group), and tumor growth was determined. Similar results were observed in three experiments. D, GM-CSF–deficient mice were reconstituted with the indicated transduced bone marrow (four per group) and, 2 mo later, injected s.c. with wild-type B16 cells as above (MFG-E8 versus GFP, P = 0.032). Similar results were observed in a second transplant experiment.

 
Because {alpha}vβ3 integrin expression is similarly increased in the vertical growth phase of melanoma (24, 25), our histologic findings raise the possibility that MFG-E8 derived from tumor and/or infiltrating myeloid cells might affect disease progression through autocrine or paracrine mechanisms. To explore this issue, we first evaluated the B16 murine melanoma model, as these cells express {alpha}vβ3 integrins (not shown) and are highly virulent when injected into syngeneic C57Bl/6 hosts. Although B16 cells did not display MFG-E8 by immunoblotting or flow cytometry (not shown), growing B16 tumors elicited myeloid cell infiltrates that expressed MFG-E8 (Fig. 1B). Single-cell suspensions prepared from s.c. lesions revealed strong MFG-E8 staining in both tumor-associated macrophages (CD11b+Gr1–) and myeloid suppressor cells (CD11b+Gr1+). Increased proportions of MFG-E8 expressing CD11b+Gr1– and CD11b+Gr1+ cells were also evident in the spleens of tumor-bearing mice compared with control littermates.

To determine the effect of tumor-derived MFG-E8 in this model, we used retroviral-mediated gene transfer to engineer B16 cells to secrete MFG-E8 constitutively. In addition, a high titer virus encoding a previously described MFG-E8 mutant, in which the RGD sequence mediating integrin engagement was modified to RGE, was constructed for comparison (33). This protein retains the capacity to bind phosphatidylserine but cannot signal through {alpha}vβ3 integrins. The MFG-E8 expression achieved with these vectors is comparable with levels found in several human melanoma cell lines (Supplementary Fig. S1). Although wild-type MFG-E8 and the RGE mutant did not significantly influence the growth of B16 cells in vitro (not shown), MFG-E8 secreting B16 cells manifested increased tumorigenicity in vivo after s.c. inoculation into wild-type C57Bl/6 mice (Fig. 1C). B16-GFP and wild-type B16 cells showed comparable growth under these conditions (not shown).

To delineate the contribution of myeloid cell–derived MFG-E8 in this model, we used GM-CSF–deficient mice, which show markedly decreased MFG-E8 expression in macrophages and dendritic cells (18). GM-CSF–deficient bone marrow was infected with retroviral vectors encoding MFG-E8, RGE, or green fluorescent protein (GFP) and then used to reconstitute lethally irradiated GM-CSF–deficient recipients. Two months after transplantation, mice were challenged with wild-type B16 cells. Mice that received MFG-E8 expressing bone marrow displayed enhanced B16 growth compared with GFP controls, whereas recipients of RGE expressing marrow evidenced a modest decrease in tumor growth (Fig. 1D). This latter inhibition might reflect increased levels of circulating IL-12 and IFN-{gamma}, which we previously showed, were due to the RGE blockade of phagocyte uptake of apoptotic cells (18). B16 growth was similarly enhanced in C57Bl/6 wild-type mice reconstituted with bone marrow transduced with MFG-E8 compared with GFP or RGE vectors (not shown). Taken together, these experiments indicate that MFG-E8, derived from either tumor or host myeloid cells, promotes B16 melanoma growth in vivo.

MFG-E8 stimulates melanoma cell resistance to apoptosis and triggers EMT. The up-regulation of {alpha}vβ3 integrins and activation of Akt in vertical growth phase melanoma cells is associated with enhanced resistance to apoptosis (23). To examine whether MFG-E8 promoted tumor cell survival, we initially characterized relevant signaling pathways by immunoblotting. Both MFG-E8 secreting B16 cells and wild-type B16 cells exposed to supernatants from MFG-E8 expressing peritoneal macrophages (generated by retroviral transduction) showed more phosphorylated Akt, phosphorylated S6 kinase, and phosphorylated STAT-3, but less phosphorylated STAT-1, compared with GFP controls and the RGE mutant (Fig. 2A ). Moreover, MFG-E8 increased the resistance of B16 cells to etoposide and fas ligation, as revealed by morphology, Annexin V/propidium iodide staining, and caspase 3 processing (Fig. 2B and C). These effects were antagonized with blocking antibodies to {alpha}vβ3 (Supplementary Fig. S2), consistent with the activation of integrin signaling. Knockdown of Akt with short hairpin RNAs (shRNA) restored B16 cell sensitivity to etoposide (Fig. 2D), delineating a contribution of this pathway to MFG-E8–mediated survival.


Figure 2
View larger version (65K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. MFG-E8 increases melanoma cell resistance to apoptosis. A, immunoblotting for survival-related proteins was performed on lysates prepared from B16-GFP, B16-MFG-E8, or B16-RGE cells and wild-type B16 cells exposed to supernatants from macrophages transduced with GFP, MFG-E8, or RGE vectors. B, the indicated B16 cells were exposed to 10 µm etoposide for 24 h, and cell death was determined by microscopy and flow cytometry with propidium iodine and Annexin V staining. C, caspase-3 activity was determined after treatment with etoposide or an agonistic anti-Fas mAb. D, Akt or control siRNAs were introduced into engineered B16 cells that were then treated with etoposide. Cell death was determined by flow cytometry as above. Similar results were observed in at least three experiments.

 
Other characteristics of vertical growth phase melanoma cells include reduced E-cadherin but increased N-cadherin and vimentin levels compared with earlier stage melanocytic lesions (27–29). This expression profile is indicative of EMT, although the factors regulating this program in vivo are not well defined (34). To investigate whether MFG-E8 contributes to these effects, we performed confocal microscopy on the engineered B16 populations. MFG-E8–expressing B16 cells showed diminished E-cadherin but robust vimentin expression compared with wild-type and RGE-expressing B16 cells (Fig. 3A ), whereas antibodies to {alpha}vβ3 integrins blocked these effects (Supplementary Fig. S3). MFG-E8 also stimulated the production of Twist and Snail (Fig. 3B), transcription factors previously linked with the induction of EMT (35–37). Indeed, knockdown of Twist with shRNAs antagonized the changes in E-cadherin and vimentin, thereby establishing the participation of Twist in MFG-E8–triggered EMT (Fig. 3C).


Figure 3
View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. MFG-E8 induces EMT in melanoma cells. A, engineered B16 cells were assayed with antibodies against E-cadherin and vimentin by confocal microscopy. B, immunoblotting of indicated B16 populations for transcription factors related to EMT. C, vimentin and E-cadherin levels after shRNA-mediated Twist knockdown in MFG-E8 secreting B16 cells. Representative of three experiments.

 
MFG-E8 enhances melanoma invasion, metastatic seeding, and angiogenesis. EMT is critical for tumor cell invasion and metastasis (35–37). In this context, MFG-E8 secreting B16 cells manifested greater invasion in Matrigel assays compared with GFP and RGE-expressing B16 cells, whereas this advantage was ameliorated by Twist but not Akt shRNA-mediated knockdown (Fig. 4A ). Melanoma cell invasion at the vertical growth phase is also promoted by the increased generation of MMPs, which degrade extracellular matrix components and some membrane proteins (38). Accordingly, supernatants from MFG-E8 secreting B16 cells stimulated greater production of MMP-2 and MMP-9 by macrophages in vitro compared with supernatants from GFP or RGE expressing B16 cells (Fig. 4B).


Figure 4
View larger version (98K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. MFG-E8 enhances melanoma invasion and metastasis. A, the indicated B16 cells were evaluated for in vitro invasion in Matrigel assays. Columns, mean for triplicates, with similar results in three experiments; bars, SD. B, peritoneal macrophages were exposed to supernatants from engineered B16 cells and assayed for MMP-2 and MMP-9 levels with ELISAs. Columns, means for triplicates, with similar results in three experiments; bars, SD. C, MFG-E8 secreting B16 cells were treated with Twist-1 or control siRNAS and injected in the tail vein of wild-type mice. Fourteen days later, lungs were harvested and subjected to pathologic analysis. The findings are representative of eight mice per group. Magnification, 100x. Arrows denote melanin in the B16 cells.

 
Consistent with these in vitro effects, MFG-E8 enhanced metastatic seeding in vivo. After tail vein injection, MFG-E8 secreting B16 cells formed multiple pulmonary metastases that were readily identified on histopathologic examination, but GFP expressing cells yielded only minimal lesions under the conditions tested (Fig. 4C). Moreover, the knockdown of Twist with shRNAs abrogated the development of lung nodules, revealing a role for this transcription factor in MFG-E8, induced tumor spread.

MFG-E8 mediates immune suppression. We previously showed that MFG-E8 inhibited vaccine-stimulated tumor immunity through the induction of Tregs (18). To determine whether MFG-E8 modulated Treg responses during tumor development, we performed flow cytometry on single-cell suspensions prepared from engineered B16 cells growing s.c. MFG-E8 secreting B16 cells evoked a dense infiltrate of CD4+FoxP3+ Tregs compared with the modest infiltrates with GFP and RGE expressing B16 cells (Fig. 5A ). The intense Treg reaction was associated with the suppression of antitumor cytotoxicity, as CD8+ T cells isolated from MFG-E8 secreting B16 tumors showed impaired IFN-{gamma} production in response to the melanosomal differentiation antigen tyrosinase-related protein-2 (Fig. 5B). NK cells harvested from the spleens of mice bearing MFG-E8 secreting B16 tumors similarly showed attenuated IFN-{gamma} production and CD107a mobilization, a measure of the perforin-granzyme lytic pathway (Fig. 5C).


Figure 5
View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. MFG-E8 mediates potent immune suppression. A, tumor-infiltrating lymphocytes were harvested from engineered B16 tumors and stained for CD4 and FoxP3. Similar results were observed in four mice per group. B, tumor-infiltrating lymphocytes were isolated and stimulated with B16 cells and IL-2 for 72 h and then tested for IFN-{gamma} production against splenocytes pulsed with TRP-2 or E1A derived peptides by ELISPOT. Columns, means for triplicates, with similar results in three experiments; bars, SD. C, NKp46+CD3– NK cells were isolated by flow cytometry from spleens of mice harboring the indicated tumors. IFN-{gamma} production and CD107a mobilization were determined by intracellular staining after exposure to Yac-1 cells. Similar results were observed in three experiments. D, the indicated macrophages were exposed to apoptotic thymocytes and cocultured with wild-type syngeneic splenocytes. FoxP3-expressing Tregs were assayed by flow cytometry. Similar results were observed in three experiments.

 
To explore the mechanism by which MFG-E8 stimulated Tregs, we cocultured syngeneic wild-type CD4+ T cells with apoptotic cell loaded peritoneal macrophages and then analyzed FoxP3 expression. Consistent with our earlier studies using GM-CSF–deficient macrophages (18), knockdown of MFG-E8 in macrophages impaired their ability to elicit Tregs in this assay (Fig. 5D). Furthermore, Twist knockdown similarly inhibited Treg induction, establishing a role for this transcription factor in MFG-E8–mediated immunoregulation.

Autocrine MFG-E8 signaling in human melanoma cells. To determine whether the effects of MFG-E8 on melanoma cell biology, as revealed in the B16 murine model, were also operative in patient specimens, we characterized six human melanoma cell lines, including four established from subjects participating in our clinical immunotherapy trials (11, 39). All samples tested showed robust MFG-E8 expression by flow cytometry (Supplementary Fig. S3), and two lines (K008 and K029) were selected for detailed study. Knockdown of MFG-E8 with shRNAs diminished phosphorylated Fak, phosphorylated Src, and phosphorylated Akt (Fig. 6A and Supplementary Fig. S4). These changes were associated with increased levels of apoptosis (Fig. 6B), suggesting that MFG-E8 promotes human melanoma cell survival through autocrine signaling.


Figure 6
View larger version (43K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. Autocrine MFG-E8 modulates melanoma cell biology in vitro. A, K008 and K028 human melanoma cells were treated with MFG-E8 or control siRNAs and evaluated by immunoblotting. B, the indicated melanoma cells were treated with 10 µm of IGF-I receptor or c-Met inhibitor for 6 h and then assayed for cell death by flow cytometry. Similar results were observed in three experiments. C, the indicated melanoma cells were evaluated for EMT by flow cytometry. Similar results were observed in three experiments. D, in vitro Matrigel invasion assays were performed with the indicated melanoma cells. Columns, means for triplicates, with similar results in three experiments; bars, SD.

 
Integrins and growth factor receptors frequently cooperate to antagonize apoptosis (40). In accordance with these observations, knockdown of MFG-E8 sensitized human melanoma cells to small molecule inhibitors of IGF-I receptor and c-Met (Fig. 6B), whereas the increased killing was reversed with the addition of recombinant MFG-E8 to the cultures (not shown). Susceptibility to MEK and ERK inhibitors, in contrast, was not consistently enhanced (not shown). MFG-E8 was also required for the expression of Twist and Snail (Fig. 6A). MFG-E8 knockdown cells displayed an attenuated EMT phenotype, with increased E-cadherin but decreased N-cadherin levels (Fig. 6C). Moreover, MFG-E8 knockdown cells showed impaired invasion in Matrigel assays (Fig. 6D). Together, these findings highlight the broad effect of MFG-E8 on human melanoma cell biology.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 References
 
Carcinogenesis involves the dynamic interplay of transformed cells and normal host elements. Cancer cells that have evaded immune-mediated destruction exploit factors present in the tumor microenvironment to accomplish disease progression. Our studies show that MFG-E8, a secreted protein expressed at high levels in the vertical growth phase, contributes to melanoma development through coordinated {alpha}vβ3 integrin signaling in tumor and myeloid cells. MFG-E8 triggers Akt and Twist-dependent pathways to stimulate tumor cell survival, EMT, invasion, and immune suppression. In the B16 murine melanoma model, these effects cooperate to enhance tumorigenicity and metastatic seeding, whereas in human melanoma cells, autocrine MFG-E8 production is required for full resistance to apoptosis, EMT, and invasive capacity. Collectively, these findings delineate pleiotropic functions for MFG-E8 in melanoma pathogenesis.

Increased expression of {alpha}vβ3 integrins on melanoma cells is the most consistent histopathologic marker for the vertical growth phase, and previous work established an important role for this receptor in melanoma biology (24, 25). Whereas vitronectin, an extracellular matrix component, serves as a major ligand under steady-state conditions, our investigations reveal a mechanism by which melanoma cells may capitalize on autocrine or paracrine MFG-E8 secretion to maintain constitutive {alpha}vβ3 integrin signaling after detachment from the basement membrane. This pathway likely provides a selective advantage to melanoma cells during invasion and dissemination. Although additional studies are required to determine the potential contributions of other {alpha}vβ3 ligands, such as Del-1, thrombospondin, and osteopontin (41, 42), our gene transfer analysis in the B16 model together with the knockdown experiments in human melanoma cells implicate a critical function for MFG-E8.

Melanoma cells acquire MFG-E8 through two complementary strategies. In one approach, infiltrating myeloid cells release the factor in a paracrine fashion. This mode is dominant in the B16 melanoma but is similarly operative in other transplantable tumors, including RENCA renal cell carcinoma, Lewis lung carcinoma, and CMS fibrosarcoma, as well as the Her2/neu transgenic breast carcinoma model (not shown). MFG-E8 expression in myeloid cells may be triggered by GM-CSF and perhaps other cytokines generated in the tumor microenvironment that may also mediate myeloid cell recruitment (18). Nonetheless, we previously showed that Toll-like receptor agonists or necrotic debris diminish MFG-E8 levels in myeloid cells. Autocrine MFG-E8 production by melanoma cells thereby constitutes an alterative scheme that might be more resistant to varying local conditions. Whereas the specific pathways that regulate MFG-E8 expression in cancer cells remain to be elucidated, p63 may be involved in some cases (43).

Myeloid cells are a major component of the host reaction to cancer, and their contributions to tumorigenesis are under active investigation (44). Tie-2 positive macrophages and myeloid suppressor cells are recruited to the developing vasculature, wherein they promote angiogenesis through the release of growth factors and MMPs (45, 46). Previous studies indicated that MFG-E8 derived from myeloid cells may be a critical cofactor for VEGF-stimulated angiogenesis (47, 48). Consistent with these results, we found that MFG-E8 production engendered intense tumor vascularity with elevated levels of VEGF and MMP-9 in situ, which might reflect the coordination of endothelial and myeloid cell responses (not shown). Moreover, the vascular remodeling and inflammatory environment might further cooperate with the MFG-E8 induced EMT to foster metastatic seeding (47, 49). Indeed, the ability of MFG-E8 released by myeloid cells to trigger Twist and Snail expression in melanoma cells highlights the intricacies of myeloid tumor cell cross-talk.

Myeloid suppressor cells attenuate protective T-cell immunity through elaborating reactive oxygen and nitrogen species and modulating arginine metabolism (17). Our investigations establish the stimulation of Tregs by MFG-E8 as an additional mechanism of immune suppression that attenuates both innate and adaptive antitumor cytotoxicity. A role for Twist in macrophage immunoregulation is consistent with previous reports, indicating that this transcription factor functions as a negative regulator of NF-{kappa}B (50). Whether Twist induces transforming growth factor-β directly will require further investigation, but the repression of proinflammatory cytokines is likely critical for Treg development and inhibition of protective Th1 responses. It is also noteworthy that MFG-E8 elicits STAT-3 activation, as this transcription factor similarly promotes tumor cell survival and immune suppression (7).

Finally, the multiple activities of MFG-E8 in the tumor microenvironment suggest several possibilities for combinatorial cancer therapies. MFG-E8 knockdown sensitized melanoma cells to small molecule inhibitors of IGF-I receptor and c-Met, consistent with the interplay of integrin and growth factor receptor signaling (40). MFG-E8 blockade might also enhance the efficacy of antiangiogenic strategies, especially those targeting VEGF. Finally, MFG-E8 inhibition might antagonize Tregs and thereby increase immune-mediated tumor destruction, particularly in conjunction with immunostimulatory approaches, such as vaccines and anti–CTLA-4 antibodies.


   Disclosure of Potential Conflicts of Interest
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
References
 
No potential conflicts of interest were disclosed.


   Acknowledgments
 
Grant support: Uehara Memorial Foundation, Kanae Foundation for the Promotion of Medical Sciences (M. Jinushi), CA78378, CA111506, AI29530, Leukemia and Lymphoma Society, Melanoma Research Alliance, and Research Foundation for the Treatment of Ovarian Cancer (G. Dranoff.).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Tyler Hichman for help with the confocal microscopy.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 6/ 5/08. Revised 7/31/08. Accepted 8/ 5/08.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Dranoff G. Cytokines in cancer pathogenesis and cancer therapy. Nat Rev Cancer 2004;41:11–22.
  2. Smyth MJ, Dunn GP, Schreiber RD. Cancer immunosurveillance and immunoediting: the roles of immunity in suppressing tumor development and shaping tumor immunogenicity. Adv Immunol 2006;90:1–50.[Medline]
  3. de Visser KE, Eichten A, Coussens LM. Paradoxical roles of the immune system during cancer development. Nat Rev Cancer 2006;61:24–37.
  4. Coussens L, Werb Z. Inflammation and cancer. Nature 2002;420:860–7.[CrossRef][Medline]
  5. Balkwill F, Charles KA, Mantovani A. Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer Cell 2005;73:211–7.
  6. Karin M, Greten FR. NF-{kappa}B: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol 2005;510:749–59.
  7. Yu H, Kortylewski M, Pardoll D. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol 2007;71:41–51.
  8. Naugler WE, Sakurai T, Kim S, et al. Gender disparity in liver cancer due to sex differences in MyD88-dependent IL-6 production. Science 2007;3175834:121–4.
  9. Rakoff-Nahoum S, Medzhitov R. Regulation of spontaneous intestinal tumorigenesis through the adaptor protein MyD88. Science 2007;3175834:124–7.
  10. Dranoff G, Jaffee E, Lazenby A, et al. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity. Proc Natl Acad Sci U S A 1993;90:3539–43.[Abstract/Free Full Text]
  11. Soiffer R, Lynch T, Mihm M, et al. Vaccination with irradiated, autologous melanoma cells engineered to secrete human granulocyte-macrophage colony stimulating factor generates potent anti-tumor immunity in patients with metastatic melanoma. Proc Natl Acad Sci U S A 1998;95:13141–6.[Abstract/Free Full Text]
  12. Hodi FS, Dranoff G. Combinatorial cancer immunotherapy. Adv Immunol 2006;90:337–60.
  13. Hodi FS, Butler M, Oble DA, et al. Immunologic and clinical effects of antibody blockade of cytotoxic T lymphocyte-associated antigen 4 in previously vaccinated cancer patients. Proc Natl Acad Sci U S A 2008;1058:3005–10.
  14. Sotomayor EM, Fu YX, Lopez-Cepero M, et al. Role of tumor-derived cytokines on the immune system of mice bearing a mammary adenocarcinoma. II. Down-regulation of macrophage-mediated cytotoxicity by tumor-derived granulocyte-macrophage colony-stimulating factor. J Immunol 1991;1478:2816–23.
  15. Serafini P, Carbley R, Noonan KA, Tan G, Bronte V, Borrello I. High-dose granulocyte-macrophage colony-stimulating factor-producing vaccines impair the immune response through the recruitment of myeloid suppressor cells. Cancer Res 2004;6417:6337–43.
  16. Gallina G, Dolcetti L, Serafini P, et al. Tumors induce a subset of inflammatory monocytes with immunosuppressive activity on CD8+ T cells. J Clin Invest 2006;11610:2777–90.
  17. Rabinovich GA, Gabrilovich D, Sotomayor EM. Immunosuppressive Strategies that are Mediated by Tumor Cells. Annu Rev Immunol 2007;25:267–96.[CrossRef][Medline]
  18. Jinushi M, Nakazaki Y, Dougan M, Carrasco DR, Mihm M, Dranoff G. MFG-E8 mediated uptake of apoptotic cells by APCs links the pro- and anti-inflammatory activities of GM-CSF. J Clin Invest 2007;117:1902–13.[CrossRef][Medline]
  19. Hanayama R, Tanaka M, Miwa K, Shinohara A, Iwamatsu A, Nagata S. Identification of a factor that links apoptotic cells to phagocytes. Nature 2002;4176885:182–7.
  20. Hanayama R, Tanaka M, Miyasaka K, et al. Autoimmune disease and impaired uptake of apoptotic cells in MFG-E8-deficient mice. Science 2004;3045674:1147–50.
  21. Miller AJ, Mihm MC, Jr. Melanoma. N Engl J Med 2006;3551:51–65.
  22. Haass NK, Smalley KS, Li L, Herlyn M. Adhesion, migration and communication in melanocytes and melanoma. Pigment Cell Res 2005;183:150–9.
  23. Govindarajan B, Sligh JE, Vincent BJ, et al. Overexpression of Akt converts radial growth melanoma to vertical growth melanoma. J Clin Invest 2007;1173:719–29.
  24. Van Belle PA, Elenitsas R, Satyamoorthy K, et al. Progression-related expression of β3 integrin in melanomas and nevi. Hum Pathol 1999;305:562–7.
  25. Danen EH, Ten Berge PJ, Van Muijen GN, Van 't Hof-Grootenboer AE, Brocker EB, Ruiter DJ. Emergence of {alpha}5β1 fibronectin and {alpha}vβ3 vitronectin-receptor expression in melanocytic tumour progression. Histopathology 1994;243:249–56.
  26. Widlund HR, Fisher DE. Microphthalamia-associated transcription factor: a critical regulator of pigment cell development and survival. Oncogene 2003;2220:3035–41.
  27. Cowley GP, Smith ME. Cadherin expression in melanocytic naevi and malignant melanomas. J Pathol 1996;1792:183–7.
  28. Li G, Satyamoorthy K, Herlyn M. N-cadherin-mediated intercellular interactions promote survival and migration of melanoma cells. Cancer Res 2001;619:3819–25.
  29. Johnson JP. Cell adhesion molecules in the development and progression of malignant melanoma. Cancer Metastasis Rev 1999;183:345–57.
  30. Brooks PC, Stromblad S, Sanders LC, et al. Localization of matrix metalloproteinase MMP-2 to the surface of invasive cells by interaction with integrin {alpha}vβ3. Cell 1996;855:683–93.
  31. Coussens LM, Tinkle CL, Hanahan D, Werb Z. MMP-9 supplied by bone marrow-derived cells contributes to skin carcinogenesis. Cell 2000;1033:481–90.
  32. Dranoff G, Crawford AD, Sadelain M, et al. Involvement of granulocyte-macrophage colony-stimulating factor in pulmonary homeostasis. Science 1994;264:713–6.[Abstract/Free Full Text]
  33. Asano K, Miwa M, Miwa K, et al. Masking of phosphatidylserine inhibits apoptotic cell engulfment and induces autoantibody production in mice. J Exp Med 2004;2004:459–67.
  34. Huber MA, Kraut N, Beug H. Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr Opin Cell Biol 2005;175:548–58.
  35. Yang J, Mani SA, Donaher JL, et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 2004;1177:927–39.
  36. Yang J, Mani SA, Weinberg RA. Exploring a new twist on tumor metastasis. Cancer Res 2006;669:4549–52.
  37. Moody SE, Perez D, Pan TC, et al. The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell 2005;83:197–209.
  38. Deryugina EI, Quigley JP. Matrix metalloproteinases and tumor metastasis. Cancer Metastasis Rev 2006;251:9–34.
  39. Soiffer R, Hodi FS, Haluska F, et al. Vaccination with irradiated, autologous melanoma cells engineered to secrete granulocyte-macrophage colony-stimulating factor by adenoviral-mediated gene transfer augments antitumor immunity in patients with metastatic melanoma. J Clin Oncol 2003;2117:3343–50.
  40. Reginato MJ, Mills KR, Paulus JK, et al. Integrins and EGFR coordinately regulate the pro-apoptotic protein Bim to prevent anoikis. Nat Cell Biol 2003;58:733–40.
  41. Hanayama R, Tanaka M, Miwa K, Nagata S. Expression of developmental endothelial locus-1 in a subset of macrophages for engulfment of apoptotic cells. J Immunol 2004;1726:3876–82.
  42. Kuphal S, Bauer R, Bosserhoff AK. Integrin signaling in malignant melanoma. Cancer Metastasis Rev 2005;242:195–222.
  43. Okuyama T, Kurata S, Tomimori Y, et al. p63(TP63) elicits strong trans-activation of the MFG-E8/lactadherin/BA46 gene through interactions between the TA and {Delta}N isoforms. Oncogene 2008;273:308–17.
  44. Condeelis J, Pollard JW. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 2006;1242:263–6.
  45. De Palma M, Murdoch C, Venneri MA, Naldini L, Lewis CE. Tie2-expressing monocytes: regulation of tumor angiogenesis and therapeutic implications. Trends Immunol 2007;2812:519–24.
  46. Yang L, Huang J, Ren X, et al. Abrogation of TGFβ signaling in mammary carcinomas recruits Gr-1+CD11b+ myeloid cells that promote metastasis. Cancer Cell 2008;131:23–35.
  47. Silvestre JS, Thery C, Hamard G, et al. Lactadherin promotes VEGF-dependent neovascularization. Nat Med 2005;115:499–506.
  48. Neutzner M, Lopez T, Feng X, Bergmann-Leitner ES, Leitner WW, Udey MC. MFG-E8/lactadherin promotes tumor growth in an angiogenesis-dependent transgenic mouse model of multistage carcinogenesis. Cancer Res 2007;6714:6777–85.
  49. Gupta GP, Nguyen DX, Chiang AC, et al. Mediators of vascular remodelling co-opted for sequential steps in lung metastasis. Nature 2007;4467137:765–70.
  50. Sosic D, Richardson JA, Yu K, Ornitz DM, Olson EN. Twist regulates cytokine gene expression through a negative feedback loop that represses NF-{kappa}B activity. Cell 2003;1122:169–80.



This article has been cited by other articles:


Home page
 Clin. Cancer Res.Home page
C. L. Slingluff Jr., G. R. Petroni, W. C. Olson, M. E. Smolkin, M. I. Ross, N. B. Haas, W. W. Grosh, M. E. Boisvert, J. M. Kirkwood, and K. A. Chianese-Bullock
Effect of Granulocyte/Macrophage Colony-Stimulating Factor on Circulating CD8+ and CD4+ T-Cell Responses to a Multipeptide Melanoma Vaccine: Outcome of a Multicenter Randomized Trial
Clin. Cancer Res., November 15, 2009; 15(22): 7036 - 7044.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
M. Jinushi, M. Sato, A. Kanamoto, A. Itoh, S. Nagai, S. Koyasu, G. Dranoff, and H. Tahara
Milk fat globule epidermal growth factor-8 blockade triggers tumor destruction through coordinated cell-autonomous and immune-mediated mechanisms
J. Exp. Med., June 8, 2009; 206(6): 1317 - 1326.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jinushi, M.
Right arrow Articles by Dranoff, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jinushi, M.
Right arrow Articles by Dranoff, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online