This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lin, P. P. Articles by Lozano, G. Search for Related Content PubMed PubMed Citation Articles by Lin, P. P. Articles by Lozano, G.

EWS-FLI1 Induces Developmental Abnormalities and Accelerates Sarcoma Formation in a Transgenic Mouse Model

Departments of ¹ Orthopaedic Oncology, ² Genetics, and ³ Pathology, University of Texas M. D. Anderson Cancer Center, Houston, Texas; and ⁴ Department of Neurobiology, Huntsman Cancer Institute, Salt Lake City, Utah

Requests for reprints: Patrick P. Lin, Section of Orthopaedic Oncology, 1400 Holcombe Boulevard, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030. Phone: 713-745-0088; Fax: 713-792-8448; E-mail: plin{at}mdanderson.org.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... References

 
Ewing's sarcoma is characterized by the t(11;22)(q24:q12) reciprocal translocation. To study the effects of the fusion gene EWS-FLI1 on development and tumor formation, a transgenic mouse model was created. A strategy of conditional expression was used to limit the potentially deleterious effects of EWS-FLI1 to certain tissues. In the absence of Cre recombinase, EWS-FLI1 was not expressed in the EWS-FLI1 transgenic mice, and they had a normal phenotype. When crossed to the Prx1-Cre transgenic mouse, which expresses Cre recombinase in the primitive mesenchymal cells of the embryonic limb bud, the EF mice were noted to have a number of developmental defects of the limbs. These included shortening of the limbs, muscle atrophy, cartilage dysplasia, and immature bone. By itself, EWS-FLI1 did not induce the formation of tumors in the EF transgenic mice. However, in the setting of p53 deletion, EWS-FLI1 accelerated the formation of sarcomas from a median time of 50 to 21 weeks. Furthermore, EWS-FLI1 altered the type of tumor that formed. Conditional deletion of p53 in mesenchymal cells (Prx1-Cre p53^lox/lox) produced osteosarcomas as the predominant tumor. The presence of EWS-FLI1 shifted the tumor phenotype to a poorly differentiated sarcoma. The results taken together suggest that EWS-FLI1 inhibits normal limb development and accelerates the formation of poorly differentiated sarcomas. [Cancer Res 2008;68(21):8968–75]

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... References

 
Ewing sarcoma is the second most common sarcoma of bone in the pediatric population, after osteosarcoma. The chimeric gene EWS-FLI1 is associated with Ewing's sarcoma (1). A reciprocal chromosomal translocation t(11;22)(q24:q12), which produces the fusion gene, occurs in nearly all patients. In variant cases, alternative translocations bearing similar fusion genes are found. Although EWS-FLI1 is suspected to be critical to the etiology of the disease, the mechanism by which it acts is not altogether clear.

Ewing's sarcoma is a unique malignancy, composed of small, poorly differentiated cells. The cells typically have scant, weakly eosinophilic cytoplasm that usually contains glycogen in the form of periodic acid Schiff-positive, diastase degradable granules, and round nuclei with evenly distribute chromatin and low mitotic activity. Immunohistochemical analysis has shown that in >90% of cases, Ewing sarcoma cells express the adhesion receptor CD 99 (2). Unlike other sarcomas, it does not exhibit any signs of differentiation that reflect a mesodermal derivation of the cells. It has been suggested that Ewing's sarcoma may be derived from primitive neuroectodermal cells because the cells carry markers shared by primitive cells of neural lineage (3, 4). Depending on the degree of neuroectodermal differentiation, Ewing sarcoma cells may also express neural cell markers, including neural-specific enolase (NSE), synaptophysin, and CD57 (5).

The EWS-FLI-1 fusion protein behaves as an aberrant transcriptional regulator (6). EWS-FLI-1 expression is required for EFT development, but the mechanisms whereby it induces transformation and/or controls tumor growth and progression are not altogether clear. Genes whose expression has been reported to be induced by EWS-FLI-1 include MYC (7), EAT-2 (8), MMP-3 (9), FRINGE (10), ID2 (11), and CCND1 (12); in contrast, TGFBR2 (13), CDKN1A (p21/CIP1/WAF1; ref. 14), and p57^KIP (15) are among those reported to be repressed.

Despite improvements in treatment for patients with localized disease (16), the prognosis for patients with patients with metastatic and relapsed disease is still poor, and it has been suggested that dose intensification with current chemotherapeutic agents may be reaching a plateau in terms of efficacy and toxicity (17, 18). In a recent query of the National Cancer Data Base of the American College of Surgeons, the survival of patients overall is still only 50% (19).

At the present time, a transgenic mouse model of Ewing's sarcoma has not been successfully created. There may be multiple reasons for this, but one obstacle may be interference with normal development of critical organs. To circumvent the possibility of embryonic lethality, a strategy of conditional expression seems desirable to limit any harmful effects of the gene to certain tissues.

Selection of the target cell or tissue for expression of EWS-FLI1 is an important issue. Previous studies have shown that expression of EWS-FLI1 or Ews-ERG in murine hematopoietic cells result in the formation of leukemias as opposed to sarcomas (20, 21). Although neuroectodermal cells have been considered by some to be the cell of origin of Ewing's sarcoma, primitive mesenchymal cells may be a better candidate. It is noteworthy that the vast majority of cases of Ewing's sarcoma arise in bone, which is of mesodermal origin. Furthermore, it has recently been shown that EWS-FLI1 can transform mesenchymal progenitor cells, which develop into undifferentiated tumors when injected into immunodeficient mice (22). The tumors share many of the morphologic features and immunohistochemical markers of Ewing's sarcoma.

The Prx1 gene is a paired-related homeobox gene that is expressed in the primitive mesenchymal tissues of the embryonic limb bud (23). A transgenic Prx1-Cre mouse has been created that uses a 2.4-kb 5' genomic region to regulate Cre expression (23). The Prx1-Cre mouse enables conditional expression of genes in the mesenchymal tissues of the extremities while sparing the central vital organs.

In the present study, we use the Prx1-Cre mouse and a strategy of conditional expression in mesenchymal cells to create a transgenic mouse with the EWS-FLI1 gene. We find that expression of EWS-FLI1 in vivo disrupts the normal development of connective tissues in the limb. EWS-FLI1 also has potent activities that accelerate the formation of sarcomas. In both of these processes, EWS-FLI1 seems to prevent maturation and differentiation of cells.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... References

 
Reagents. Tris, glycine, NaCl, sodium dodecyl sulfide, and bovine serum albumin were purchased from Sigma-Aldrich. Rabbit polyclonal antibody to EWS-FLI-1 (BL2479) was obtained from Bethyl Laboratories, Inc. This was directed against synthetic peptide that represented the point of fusion between EWS and Fli1 as predicted in Genbank entry ACA62796.1. More specifically, the peptide contained the residues 263-QQNPS-267 of ACA62796.1 with additional residues from upstream and downstream to present the point of fusion in a context similar to that which one might expect for the protein predicted by entry ACA62796.1. Rabbit anti– c-myc, goat anti-Manic fringe, rabbit anti-TGFβRII, mouse anti-p21WAF1, and rabbit anti-NSE were obtained from Santa Cruz Biotechnology. Antibody against β-actins was purchased from Sigma-Aldrich. Vectastain ABC kit was obtained from Vector Laboratories.

Mice. The Prx1-Cre (23), CMV-Cre (24), Zp3-Cre (25), and p53^lox (26) mice have been previously described. All mice were maintained in a C57Bl/6 background.

Generation of EWS-FLI1 transgenic mouse. To establish the EWS-FLI-1 mouse model, type I EWS-FLI1 (7–6) fusion gene was inserted into the Not1 and EcoRI sites of construct pCLE2, a modified form of pCX-GFP (27) that included the chick β actin promoter and cytomegalovirus enhancer (Fig. 1A ). The EWS-FLI1 gene was placed downstream of the enhanced green fluorescent protein (EGFP) gene, which was flanked by loxP sites. The construct was designed to enable screening of transgenic pups by EGFP. In the absence of Cre recombinase, EWS-FLI1 should not be expressed. After excising the construct with restriction enzymes Sal I and HindIII, the DNA was purified and then injected into embryos. Viable pups were screened by EGFP fluorescence under UV light and PCR of tail DNA. Three mouse lines were selected (designated EF-a, EF-b, and EF-c). Southern blot analysis was used to verify each line (data not shown). The copy numbers carried by each line was assessed by quantitative PCR (Fig. 1B), using DNA from tail preparations. The primers for EWS-FLI1 spanning the junction site were EWS-FLI1 were Forward 5'AACAGAGCAGCAGCTACGGG and Reverse 5'TGTTATTGCCCCAAGCTCCT. In the absence of Cre recombinase, no abnormal phenotype was observed. All three transgenic lines were viable and reproductively fertile. The mice were maintained in a C57Bl/6 background.

View larger version (26K): [in this window] [in a new window] [Download PPT slide]   Figure 1. Cloning scheme and characterization of the type 1 EWS-FLI1 transgenic construct. A, Cre-lox mediated recombination was the strategy used for creating the conditional allele. The DNA construct for the EWS-FLI1 transgenic mouse is shown. The CLE2 plasmid was generated by inserting loxP sites into the EcoR1 restriction sites of pCX-GFP. The CAG promoter consists of the CMV enhancer and the chick β actin core promoter. The gene for EGFP is flanked by loxP sites. In the presence of Cre recombinase, the EGFP cassette is excised, thereby enabling the EWS-FLI1 gene to be expressed. B, quantitative PCR was performed to analyze mouse tail DNAs for the copy number of EWS-FLI1 of each transgenic line. The copy number was determined by comparison against wild-type genomic DNA that had been added to 1, 5, or 10 copies of the EWS-FLI1 transgene per genome equivalent DNA.

Histology and immunohistochemistry. Tissues were fixed in 10% buffered formalin, embedded in paraffin, and submitted for histology. Sections were cut to 5 to 7 µm thickness and stained. Tumor samples were reviewed by a veterinary pathologist (CVP) to determine the tumor subtype.

The paraffin-embedded sections were stained with either rabbit anti–EWS-FLI1 antibody or rabbit anti-NSE (Santa Cruz Biotechnology). Slides were incubated in primary antibodies (1:200 dilution) overnight in the cold room followed by incubation with respective secondary antibodies for 60 min using the Vectastain ABC kit (Vector Laboratories). Counterstaining was done with nuclear fast red or hematoxylin.

Western blot analysis. To detect various proteins, either tissue or cells were extracted by 0.05 mL lysis buffer containing 20 mmol/L HEPES (pH 7.4), 2 mmol/L EDTA, 250 mmol/L NaCl, 0.1% NP40, 2 µg/mL leupeptin, 2 µg/mL aprotinin, 1 mmol/L phenylmethylsulfonyl fluoride, 0.5 µg/mL benzamidine, 1 mmol/L dthiothreitol, and 1 mmol/L sodium vanadate by incubation for 30 min on ice. The lysate was centrifuged and the supernatant was collected. Whole-cell protein (30 µg) was resolved on 7.5% to 12% SDS-PAGE, transferred onto a nitrocellulose membrane, blotted with antibodies, and then detected by chemiluminescence (Amersham).

Real-time quantitative reverse transcription-PCR. Total RNA was extracted from tissues or cells with Trizol (Invitrogen) and further purified by the RNeasy kit (Qiagen). Reverse transcriptase reactions were performed with the First-Strand cDNA Synthesis kit (Amersham Bioscience). Primers for EWS-FLI1 were Forward 5'AACAGAGCAGCAGCTACGGG and Reverse 5'TGTTATTGCCCCAAGCTCCT. The PCR reactions were performed in 96-well reaction plates using an ABI PRISM 7900 Sequence Detection System (Applied Biosystems). Each sample was measured in duplicate. The relative level of expression was determined by Ct normalized to endogenous control (glyceraldehyde-3-phosphate dehydrogenase; GAPDH).

Statistical analysis. The SPSS 12.0 computer program was used to perform statistical calculations. Statistical significance was defined as a P value of 0.05. The log-rank test was used to compare survival curves with Kaplan-Meier analysis. The ² test was used to compare the distribution of different types of tumors.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... References

 
Limb development. A construct of the EWS-FLI1 gene driven by the chick β actin promoter was designed to enable conditional expression. The EGFP gene was present upstream of the EWS-FLI1 gene and flanked by loxP sites.

After injection of embryos with the EWS-FLI1 DNA construct, three transgenic mouse lines (EF-a, EF-b, EF-c) were selected by fluorescence under UV light. The presence of the transgene was confirmed by PCR genotyping. In the absence of Cre recombinase, all of the mice had a normal appearance without any detectable abnormalities (Fig. 2A ).

View larger version (40K): [in this window] [in a new window] [Download PPT slide]   Figure 2. After crossing to the Prx1-Cre transgenic mice, abnormalities are observed in the limbs of double-positive offspring carrying both the Prx1-Cre and EWS-FLI1 genes. A, the newborn control pup has normal limbs (arrow). B, the EF-a newborn pup has shortened limbs but a normal crown-rump length. C, the EF-b newborn pup has curved arthrogrypotic-like limbs with six digits in all limbs. D, the EF-c embryo at E14.5 shows severe abnormality of the limbs, with no discernible formation of joints, bones, hands, or feet. The EF-c line does not produce viable pups when crossed to Prx1-Cre.

To achieve conditional expression of EWS-FLI1 in the limbs, the three transgenic lines were crossed to the Prx1-Cre transgenic mouse. The Prx1-Cre transgenic mouse was selected for two main reasons. First, in previous experiments,⁵ we ascertained that Prx1 does affect most of the mesenchymally derived cells and this is consistent with the published reports using lacZ reporter genes that show expression of Prx1 in the mesodermally derived tissues of the limb bud (23). Second, our strategy was to induce expression of EWS-FLI1 at an early stage in mesenchymal cell development because the cell of origin of Ewing's sarcoma may be from an undifferentiated mesenchymal cell. Double-positive offspring carrying both the Prx1-Cre and EWS-FLI1 genes exhibited varying degrees of limb deformities (Fig. 2B–D). The phenotype was reproducible for each EWS-FLI1 transgenic line, and we observed 100% penetrance of the limb phenotype in each transgenic line when crossed with Prx1-Cre mice. The EF-a mouse was characterized by severely shortened, atrophic limbs (Fig. 2B). The EF-b mouse was marked by minimally shortened, dysplastic limbs with duplication of the thumb and great toe (Fig. 2C). Both of these short-limbed mice had normal life span (beyond 2 years). The EF-c mouse was distinguished by severe limb deformities that lacked differentiation into digits or long bones in utero (Fig. 2D). These mice did not produce viable pups with the genotype Prx1-Cre EWS-FLI1.

Histologic examination of various tissues of the limbs showed abnormalities of the musculoskeletal system in the Prx1-Cre EWS-FLI1 mice (Fig. 3 ). The effects were more pronounced for the EF-a line. In addition to marked shortening of the bones, there was muscular atrophy, endomysial fibrosis, cartilaginous dysplasia, and osteodystrophy. Both the articular cartilage and the bone had features of immature, incompletely organized tissue. There was an abundance of immature, woven bone present in the cortical bone of the midshaft of the femur, which normally is composed of highly organized trabecular bone. The EF-b line had histologic findings similar to the EF-b but to a lesser extent. Bone, muscle, and cartilage were all affected. The severity of limb deformity in the EF-c line precluded further analysis.

View larger version (79K): [in this window] [in a new window] [Download PPT slide]   Figure 3. The EF transgenic mice exhibit multiple abnormalities of the limbs when crossed to Prx1-Cre. The effects are generally more severe for the EF-a mouse line. A (i–iii), Faxitron X-rays of adult mice at 6 wk show marked shortening of the long bones of the EF-a mice (ii) and duplication of digits in the EF-b mice (white arrows, iii) when compared with normal mice (i). Histologically, a number of aberrations were found. B (i–iii), skeletal muscles of the quadriceps were stained with trichrome and shown at low-power magnification (black bar, 1,000 µm). The muscles of the EF-a mice (ii) and EF-b mice (iii) showed attenuation of the muscle fiber diameter and decrease in overall muscle mass compared with normal control (i). Degeneration of individual fibers and central location of nuclei can be observed. An increase in endomysial fibrosis is observed in the EF mice compared with normal mice. C (i–iii), Toluidine blue stain of the articular cartilage of the knee showed dysplastic and degenerative features (articular chondromatosis) in the EF-a mice (ii) and EF-b mice (iii) compared with normal mice (i). There is clustering of cells in multiple lacunae and loss of columnar arrangement of chondrocytes. D (i–iii), H&E staining of cortical femoral bone under polarized light shows well-organized trabecular bone in the normal mouse (i) but an abundance of poorly organized, immature, woven bone (blue arrow) in the EF-a mouse (ii). A scant amount of mature lamellar bone (black arrow) is seen. The EF-b mouse (iii) also shows woven bone and impaired maturation but to a lesser extent than the EF-a mouse.

Although the EWS-FLI1 gene did not generate tumors in the mice by itself, the possibility existed that it might cooperate with other mutations to affect tumor formation. Therefore, the EWS-FLI1 gene was introduced into mice with deletion of p53.

Using the Prx1-Cre transgenic mouse, conditional deletion of p53 in the mesenchymal cells of the limbs was achieved. Mice with a homozygous deletion of p53 (Prx1-Cre p53^lox/lox) developed sarcomas at a median time of 50 weeks from birth (Fig. 4 ). The majority of these tumors were osteosarcomas (70%), followed by pleomorphic soft tissue sarcomas (17%).

View larger version (50K): [in this window] [in a new window] [Download PPT slide]   Figure 4. In a model of sarcoma formation based on conditional deletion of p53 (Prx1-Cre p53lox/lox), the presence of EWS-FLI1 altered the phenotype of the sarcoma and accelerated the time to onset of sarcomas. A, X-ray of the tibia shows exuberant periosteal bone formation in a mouse with EWS-FLI1. B, in most tumors arising in mice carrying EWS-FLI1, a poorly differentiated sarcoma was found with large, pleomorphic nuclei, scant cytoplasm, and compact cells (H&E). C, in two cases, a small amount of osteoid was observed (arrow), and in these cases the tumors were classified as osteosarcoma. The amount of osteoid was markedly less than typical cases of osteosarcoma, which were the predominant tumor type in mice without EWS-FLI1. D, survival curves of mice bearing the genotypes EWS-FLI1 Prx1-Cre p53lox/lox (p53-del + EF) and Prx1-Cre p53lox/lox (p53-del) showed significantly worse survival when EWS-FLI1 was present (P < 0.0001). The median survival was 21 wk with EWS-FLI1 compared with 50 wk without EWS-FLI1.

View larger version (45K): [in this window] [in a new window] [Download PPT slide]   Figure 5. A, Western blot analysis showed expression of EWS-FLI1 and several of its functional targets, including manic fringe, c-myc, p21WAF1, and TGF-β RII in bone (Tg bone) compared with the Ewing's sarcoma cell line TC-71 and expression in three separate tumor specimens (genotype Prx1-Cre p53lox/lox EWS-FLI1). All of the tumors were from the EF-a transgenic mouse line. B, immunohistochemistry with EWS-FLI-1 antibody showed diffuse staining of cells from a tumor (Prx1-Cre p53lox/lox EWS-FLI1) but little staining in muscle or spleen from the same mouse. C, immunohistochemistry showed staining of cells for NSE from a tumor expressing EWS-FLI1 [right; genotype Prx1-Cre p53lox/lox EWS-FLI1 (EF-a)]. The staining for NSE can be observed in patchy areas and sporadic cells. In comparison, there is no staining for NSE in sarcomas obtained by conditional knockout of p53 without the presence of EWS-FLI1 (left; genotype Prx1-Cre p53lox/lox). D, the expression of mRNA is shown for various specimens. qRT-PCR analyses showed a greater level of mRNA expression of EWS-FLI-1 in the tumor specimen compared with normal bone, muscle, and spleen from the same animal. Each sample was normalized against levels of GAPDH and each symbol denotes the mean value of a sample analyzed in triplicate.

The expression of a number of genes has been reported to be affected by EWS-FLI-1. These include manic fringe (10), c-myc (7), p21^WAF1 (14), and transforming growth factor β (TGF-β) type II receptor (TGF-β RII; ref. 13). In tumors derived from mice bearing the genotype Prx1-Cre EWS-FLI1 [EF-a] p53^lox/lox, there is up-regulation of the level of expression of c-myc and manic fringe. Concomitantly, there is down-regulation of the level of expression of p21^WAF1 and TGF-β RII (Fig. 5A).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... References

 
EWS-FLI1 has important effects on development of the mouse limb. Transgenic mice show short limb phenotypes with muscle atrophy. The findings correlate nicely with the observations of Eliazer and colleagues (28), who found that EWS-FLI1 had a profound inhibitory effect on the ability of cells in culture to differentiate into muscles. EWS-FLI1 has also been reported to have inhibitory effects on osteoblastic differentiation (29) and neural differentiation in cell culture (30). Our in vivo results are consistent with these findings. The bones of the EF transgenic mice showed abundant woven bone and impairment of bone maturation. Although it was difficult to examine the nerves histologically, we did notice aberrations in cartilaginous development.

The results of this study suggest that the EWS-FLI1 oncoprotein is lethal to the developing mouse embryo. No pups were recovered with constitutive global expression of EWS-FLI1. The finding is important for future work with the gene in vivo. It is likely that strategies for studying the gene must limit its expression to specific tissues or certain temporal sequences.

The level of expression of EWS-FLI1 was found to be low in adult tissues of the EF transgenic mice. The reason for this is not altogether clear, but it may be related to the deleterious effects on normal development. It is likely that cells expressing EWS-FLI1 do not divide and differentiate in a normal manner. In untransformed cells, the EWS-FLI1–expressing cell may be arrested in its differentiation in a primitive state. Previous work has shown that EWS-FLI1 arrests growth of human fibroblasts (31) and induces apoptosis in mouse embryonic fibroblasts (32). The fact that Ewing's sarcoma is composed of undifferentiated, primitive cells is consistent with the notion that EWS-FLI1 arrests cells at an early stage of differentiation.

In tumors, there is an apparent up-regulation of EWS-FLI1. There are several possible explanations for this finding. An increase in the level of expression of each individual cell is certainly possible. However, it may be more likely that there is an enrichment of the proportion of cells expressing EWS-FLI1. In non-neoplastic tissues of transgenic EF mice, the expression of EWS-FLI1 may be restricted to primitive, undifferentiated cells that form a small proportion of the total number of cells. Cells that successfully differentiate may possess mechanisms for dampening or abrogating the expression of EWS-FLI1.

By itself, EWS-FLI1 does not seem to be a strong initiator of sarcoma formation in murine mesenchymal cells. Tumors were observed only in the background of p53 deletion. These results strongly point to the existence of additional cooperative mutations that are essential for the transformation process with EWS-FLI1. The fact that p53 was found to have synergistic effects with EWS-FLI1 is consistent with clinical observations. Ewing's sarcoma is associated with mutations of tumor suppressor genes such as p53 and p16 in a significant percentage of cases (33). Other mutations may also be involved, and future work is needed to identify these genes.

The relationship between EWS-FLI1 and p53 is intriguing. It has been reported that EWS-FLI1 induces a p53-dependent growth arrest in primary human fibroblasts (31). The absence of p53 may create a more permissive environment for the cell to continue to divide. Disruption of the p53 pathway may therefore be crucial to the process by which EWS-FLI1 transforms the cell. This disruption may not necessarily involve actual mutation of p53. Mutation of other genes in the pathway may achieve the same effect.

The lack of tumors in animals expressing only EWS-FLI1 without other mutations could be the result of a number of factors. Species differences in the molecules interacting with EWS-FLI1 could alter the effects of the gene. The mouse may have slightly different mechanisms governing cell growth and differentiation of mesenchymal cells.

Another potential explanation for why EWS-FLI1 alone did not induce tumors is that the cell of origin may not be a mesenchymal cell. The cells of Ewing's sarcoma carry certain differentiation markers that suggest a relationship to primitive neuroectodermal cells (3, 4). However, it is possible that these markers are induced by the presence of EWS-FLI1. Recent work has shown that a rhabdomyosarcoma cell line up-regulates neuron-associated genes when EWS-FLI1 expression is induced (34). In another study, human mesenchymal progenitor cells transformed by EWS-FLI1 acquired the cell surface marker NSE (22). This marker is also present on Ewing's sarcoma cells (35). We observed some expression of NSE in the tumor samples carrying EWS-FLI1 transgene. Although further work is necessary to elucidate the cell of origin, it seems reasonable at this time to continue investigating the effects of EWS-FLI1 on primitive mesenchymal cells.

In summary, the EWS-FLI1 oncoprotein has profound effects on limb development in the mouse. Transgenic mice that express EWS-FLI1 in the embryonic limb bud develop severe limb shortening and developmental defects. The phenotype of the mice suggests that EWS-FLI1 impairs differentiation of mesenchymal cells. EWS-FLI1 is not a strong initiator of sarcoma formation in the mouse. However, it accelerates the formation of sarcomas and strongly favors the generation of poorly differentiated sarcomas when expressed in cells with a p53 null mutation.

	Disclosure of Potential Conflicts of Interest

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... References

 
No potential conflicts of interest were disclosed.

	Acknowledgments

 
Grant support: Onstead Foundation, the Orthopaedic Research and Education Foundation, and the Texas ARP/ATP Program.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Anton Berns for the P53^lox mouse, Jim Martin for the Prx1-Cre mouse. Histology of mouse tissues was performed by Carolyn Van Pelt. The EWS-FLI1 antibody was a gift from Eric McIntush (Bethyl Laboratories), who developed the antibody.

	Footnotes

 
⁵ P.P. Lin, M.K. Pandey, F. Jin, S. Xiong, G. Lozano, unpublished data.

Received 2/14/08. Revised 8/19/08. Accepted 8/20/08.

	References

Top Abstract Introduction Materials and Methods Results Discussion Disclosure of Potential... References

 

1. Delattre O, Zucman J, Plougastel B, et al. Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature 1992;359:162–5.[CrossRef][Medline]
2. Dejana E. Endothelial cell-cell junctions: happy together. Nat Rev Mol Cell Biol 2004;5:261–70.[CrossRef][Medline]
3. Cavazzana AO, Miser JS, Jefferson J, Triche TJ. Experimental evidence for a neural origin of Ewing's sarcoma of bone. Am J Pathol 1987;127:507–18.[Abstract]
4. Rettig WJ, Garin-Chesa P, Huvos AG. Ewing's sarcoma: new approaches to histogenesis and molecular plasticity. Lab Invest 1992;66:133–7.[Medline]
5. Ushigome S, Machinami R, Sorensen PH. Ewingsarcoma/primitive neuroectodermal tumor. Fletcher CDM, Unni KK, Mertens F, editors. WHO Classification of Tumors, Pathology and Genetics, Tumors of Soft Tissue and Bone. Lyon: IARC Press, 2003.
6. May WA, Lessnick SL, Braun BS, et al. The Ewing's sarcoma EWS/FLI-1 fusion gene encodes a more potent transcriptional activator and is a more powerful transforming gene than FLI-1. Mol Cell Biol 1993;13:7393–8.[Abstract/Free Full Text]
7. Bailly RA, Bosselut R, Zucman J, et al. DNA-binding and transcriptional activation properties of the EWS-FLI-1 fusion protein resulting from the t(11;22) translocation in Ewing sarcoma. Mol Cell Biol 1994;14:3230–41.[Abstract/Free Full Text]
8. Thompson AD, Braun BS, Arvand A, et al. EAT-2 is a novel SH2 domain containing protein that is up regulated by Ewing's sarcoma EWS/FLI1 fusion gene. Oncogene 1996;13:2649–58.[Medline]
9. Braun BS, Frieden R, Lessnick SL, May WA, Denny CT. Identification of target genes for the Ewing's sarcoma EWS/FLI fusion protein by representational difference analysis. Mol Cell Biol 1995;15:4623–30.[Abstract]
10. May WA, Arvand A, Thompson AD, Braun BS, Wright M, Denny CT. EWS/FLI1-induced manic fringe renders NIH 3T3 cells tumorigenic. Nat Genet 1997;17:495–7.[CrossRef][Medline]
11. Fukuma M, Okita H, Hata J, Umezawa A. Upregulation of Id2, an oncogenic helix-loop-helix protein, is mediated by the chimeric EWS/ets protein in Ewing sarcoma. Oncogene 2003;22:1–9.[CrossRef][Medline]
12. Wai DH, Schaefer KL, Schramm A, et al. Expression analysis of pediatric solid tumor cell lines using oligonucleotide microarrays. Int J Oncol 2002;20:441–51.[Medline]
13. Hahm KB, Cho K, Lee C, et al. Repression of the gene encoding the TGF-β type II receptor is a major target of the EWS-FLI1 oncoprotein. Nat Genet 1999;23:222–7.[CrossRef][Medline]
14. Nakatani F, Tanaka K, Sakimura R, et al. Identification of p21WAF1/CIP1 as a direct target of EWS-Fli1 oncogenic fusion protein. J Biol Chem 2003;278:15105–15.[Abstract/Free Full Text]
15. Dauphinot L, De Oliveira C, Melot T, et al. Analysis of the expression of cell cycle regulators in Ewing cell lines: EWS-FLI-1 modulates p57KIP2and c-Myc expression. Oncogene 2001;20:3258–65.[CrossRef][Medline]
16. Grier HE, Krailo MD, Tarbell NJ, et al. Addition of ifosfamide and etoposide to standard chemotherapy for Ewing's sarcoma and primitive neuroectodermal tumor of bone. N Engl J Med 2003;348:694–701.[Abstract/Free Full Text]
17. Kushner BH, Cheung NK, Kramer K, Dunkel IJ, Calleja E, Boulad F. Topotecan combined with myeloablative doses of thiotepa and carboplatin for neuroblastoma, brain tumors, and other poor-risk solid tumors in children and young adults. Bone Marrow Transplant 2001;28:551–6.[CrossRef][Medline]
18. Rodriguez-Galindo C, Daw NC, Kaste SC, et al. Treatment of refractory osteosarcoma with fractionated cyclophosphamide and etoposide. J Pediatr Hematol Oncol 2002;24:250–5.[CrossRef][Medline]
19. Damron TA, Ward WG, Stewart A. Osteosarcoma, chondrosarcoma, and Ewing's sarcoma: National Cancer Data Base Report. Clin Orthop Relat Res 2007;459:40–7.[CrossRef][Medline]
20. Torchia EC, Boyd K, Rehg JE, Qu C, Baker SJ. EWS/FLI-1 induces rapid onset of myeloid/erythroid leukemia in mice. Mol Cell Biol 2007;27:7918–34.[Abstract/Free Full Text]
21. Codrington R, Pannell R, Forster A, et al. The Ews-ERG fusion protein can initiate neoplasia from lineage-committed haematopoietic cells. PLoS Biol 2005;3:e242.[CrossRef][Medline]
22. Riggi N, Cironi L, Provero P, et al. Development of Ewing's sarcoma from primary bone marrow-derived mesenchymal progenitor cells. Cancer Res 2005;65:11459–68.[Abstract/Free Full Text]
23. Logan M, Martin JF, Nagy A, Lobe C, Olson EN, Tabin CJ. Expression of Cre Recombinase in the developing mouse limb bud driven by a Prxl enhancer. Genesis 2002;33:77–80.[CrossRef][Medline]
24. Schwenk F, Baron U, Rajewsky K. A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells. Nucleic Acids Res 1995;23:5080–1.[Free Full Text]
25. Lewandoski M, Wassarman KM, Martin GR. Zp3-cre, a transgenic mouse line for the activation or inactivation of loxP-flanked target genes specifically in the female germ line. Curr Biol 1997;7:148–51.[CrossRef][Medline]
26. Marino S, Vooijs M, van Der Gulden H, Jonkers J, Berns A. Induction of medulloblastomas in p53-null mutant mice by somatic inactivation of Rb in the external granular layer cells of the cerebellum. Genes Dev 2000;14:994–1004.[Abstract/Free Full Text]
27. Ikawa M, Kominami K, Yoshimura Y, Tanaka K, Nishimune Y, Okabe M. A rapid and non-invasive selection of transgenic embryos before implantation using green fluorescent protein (GFP). FEBS Lett 1995;375:125–8.[CrossRef][Medline]
28. Eliazer S, Spencer J, Ye D, Olson E, Ilaria RL, Jr. Alteration of mesodermal cell differentiation by EWS/FLI-1, the oncogene implicated in Ewing's sarcoma. Mol Cell Biol 2003;23:482–92.[Abstract/Free Full Text]
29. Torchia EC, Jaishankar S, Baker SJ. Ewing tumor fusion proteins block the differentiation of pluripotent marrow stromal cells. Cancer Res 2003;63:3464–8.[Abstract/Free Full Text]
30. Rorie CJ, Thomas VD, Chen P, Pierce HH, O'Bryan JP, Weissman BE. The Ews/Fli-1 fusion gene switches the differentiation program of neuroblastomas to Ewing sarcoma/peripheral primitive neuroectodermal tumors. Cancer Res 2004;64:1266–77.[Abstract/Free Full Text]
31. Lessnick SL, Dacwag CS, Golub TR. The Ewing's sarcoma oncoprotein EWS/FLI induces a p53-dependent growth arrest in primary human fibroblasts. Cancer Cell 2002;1:393–401.[CrossRef][Medline]
32. Deneen B, Denny CT. Loss of p16 pathways stabilizes EWS/FLI1 expression and complements EWS/FLI1 mediated transformation. Oncogene 2001;20:6731–41.[CrossRef][Medline]
33. Huang HY, Illei PB, Zhao Z, et al. Ewing sarcomas with p53 mutation or p16/p14ARF homozygous deletion: a highly lethal subset associated with poor chemoresponse. J Clin Oncol 2005;23:548–58.[Abstract/Free Full Text]
34. Hu-Lieskovan S, Zhang J, Wu L, Shimada H, Schofield DE, Triche TJ. EWS-FLI1 fusion protein up-regulates critical genes in neural crest development and is responsible for the observed phenotype of Ewing's family of tumors. Cancer Res 2005;65:4633–44.[Abstract/Free Full Text]
35. Amann G, Zoubek A, Salzer-Kuntschik M, Windhager R, Kovar H. Relation of neurological marker expression and EWS gene fusion types in MIC2/CD99-positive tumors of the Ewing family. Hum Pathol 1999;30:1058–64.[CrossRef][Medline]

This article has been cited by other articles:

				J. L. Ordonez, D. Osuna, D. Herrero, E. de Alava, and J. Madoz-Gurpide Advances in Ewing's Sarcoma Research: Where Are We Now and What Lies Ahead? Cancer Res., September 15, 2009; 69(18): 7140 - 7150. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Lin, P. P. Articles by Lozano, G. Search for Related Content PubMed PubMed Citation Articles by Lin, P. P. Articles by Lozano, G.