
Cancer Research 68, 9157, November 15, 2008. doi: 10.1158/0008-5472.CAN-08-1323
© 2008 American Association for Cancer Research
Cell, Tumor, and Stem Cell Biology |
Bone Morphogenetic Protein-7 Inhibits Telomerase Activity, Telomere Maintenance, and Cervical Tumor Growth
Lucy Cassar,
He Li,
Alexander Ruvantha Pinto,
Craig Nicholls,
Sharyn Bayne and
Jun-Ping Liu
Department of Immunology, Central Eastern Clinical School, Monash University, Melbourne, Australia
Requests for reprints: Jun-Ping Liu or He Li, Department of Immunology, Central Eastern Clinical School, Alfred Medical Research and Education Precinct, Commercial Road, Prahran, Victoria 3181, Australia. Phone: 61-3-99030715; Fax: 61-3-99030120; E-mail: jun-ping.liu{at}med.monash.edu.au or he.li{at}med.monash.edu.au.
 |
Abstract
|
|---|
Telomere maintenance is critical in tumor cell immortalization. Here, we report that the cytokine bone morphogenetic protein-7 (BMP7) inhibits telomerase activity that is required for telomere maintenance in cervical cancer cells. Application of human recombinant BMP7 triggers a repression of the human telomerase reverse transcriptase (hTERT) gene, shortening of telomeres, and hTERT repression–dependent cervical cancer cell death. Continuous treatment of mouse xenograft tumors with BMP7, or silencing the hTERT gene, results in sustained inhibition of telomerase activity, shortening of telomeres, and tumor growth arrest. Overexpression of hTERT lengthens telomeres and blocks BMP7-induced tumor growth arrest. Thus, BMP7 negatively regulates telomere maintenance, inducing cervical tumor growth arrest by a mechanism of inducing hTERT gene repression. [Cancer Res 2008;68(22):9157–66]
 |
Introduction
|
|---|
Bone morphogenetic proteins (BMPs) operate through autocrine and paracrine mechanisms to regulate cell proliferation, differentiation, and apoptosis during development (1, 2). Similar to other transforming growth factor-β (TGF-β) family members, BMPs bind cell membrane type I and II receptors of serine/threonine kinases eliciting intracellular signaling via Smad1, Smad5, Smad8 and Smad9 proteins (3, 4), and the Lim kinase (5, 6), and mitogen-activated protein kinase pathways (7, 8). BMPs are present in cancers including breast, prostate, and colon cancers (9–11) where BMPs are implicated in regulating cancer cell proliferation (8, 12–14). BMP7 (osteogenic protein-1) is a potent inducer of cell differentiation required for vertebrate development, deletion of which is postnatal-lethal with multiple defects in differentiated tissues (15). Recent studies show that BMP7 maintains epithelial and endothelial phenotypes against epithelial-mesenchymal transition (16, 17). BMP7 inhibits cancer cell proliferation causing apoptosis of myeloma cells (12) and prostate cancer cells (13, 18), and inhibits breast (19) and prostate (16) cancer metastasis. However, apart from BMP7 antagonizing TGF-β–mediated proinvasive and protumorigenic effects (16, 17, 19), the exact mechanisms in gene expression underlying these inhibitory actions of BMP7 in cancer remain unknown.
Cancer cells hold unlimited proliferative potential as the cells maintain their telomeres (ends of chromosomes) when they divide. Most cancer cells maintain telomeres by mechanisms requiring the ribonucleoprotein complex telomerase (20). Telomerase is thus crucial to cancer cell proliferation toward immortalization. Containing human telomerase reverse transcriptase (hTERT), human RNA template component, and its binding protein dyskerin, telomerase catalyses telomeric DNA synthesis and protects telomere ends (21–23). As the catalyst of telomerase complex, hTERT is rate limiting and expressed specifically in most cancers to maintain short telomeres. Ectopic expression of hTERT lengthens telomeric DNA, stabilizes telomeres, and mediates cell immortalization (24, 25). Inhibition of hTERT by gene silencing, dominant-negative gene expression, or substrate competitive inhibitors accelerates telomere shortening and thereby triggers cancer cell senescence and apoptosis in cell cultures and tumors (24, 25).
To date, little is known of how hTERT is regulated in cells by extracellular cues. Considerable evidence indicates that when normal cells differentiate in most tissues and organs, hTERT gene expression becomes repressed, conferring a limited length of telomeres and therefore proliferative potential on cells (26, 27). Repression of the hTERT gene occurs at the gene transcription level under a concerted regulation by a number of transcription factors and repressors (28–30). We hypothesize that extracellular factors regulating cell differentiation exert an effect on hTERT gene expression, telomerase activity, and telomere maintenance through intracellular signaling. Studies from our laboratory and others show that TGF-β can induce an hTERT gene repression (30–35). In the present study, we have examined effects of the BMP family on telomerase activity and telomere maintenance in cervical cancer cells. We show that BMP7 induces sustained telomerase inhibition and telomere shortening in vitro and in vivo, resulting in cancer cell apoptosis by a mechanism involving the repression of the hTERT gene and telomerase activity.
 |
Materials and Methods
|
|---|
Cytokines, gene expression plasmids, and antibodies. Human recombinant BMP 2, 4, 5, 6, and 7 were from R & D systems. Plasmid pEGFP-C1, pEGFP-C1-hTERT, and pEGFP-C1-hTERT shRNA were produced in this laboratory. For hTERT shRNA, the oligonucleotide (5'-AATTCAAAAAGGGTCTTTCTACCAGAGGTGCTTCTCTTGAAATCATCTCTGGTAGCAAGACC-3) was annealed and cloned to the EcoR1 site downstream of the U6 promoter. All plasmids were verified by DNA sequencing. The primary antibodies of mouse anti–c-myc, mouse anti-p53, and mouse anti-p21 were from Santa Cruz Biotechnology, rabbit anti-p16 were from Cell Signaling Technology, mouse anti-actin were from Chemicon, and horseradish peroxidase–coupled second antibodies were from Dako.
Cell culture and treatment. Human cervical cancer HeLa cells were grown in 5% CO2 atmosphere at 37°C in DMEM (Invitrogen) containing 10% fetal bovine serum (FBS) in 6-well plastic plates or 10-cm dishes (Nunc). Recombinant BMP proteins at concentrations of 0.1, 0.3, 3, 10, and 30 ng/mL were added to cell cultures for various periods of time as indicated in individual experiments, in which the serum concentration was 0.5% in the cell culture medium. Cells were lysed in ice cold CAHPS lysis buffer (0.5% 3-[(Cholamidopropyl)dimethylammonio]-1-propanesulfonate, 10 mmol/L Tris (pH 7.5), 1 mmol/L MgCl2, 1 mmol/L EGTA, 0.1 mmol/L benzamidine, 5 mmol/L β-mercaptoethanol, and 10% glycerol), in the presence of complete mini protease inhibitors (Roche Diagnostic). Clarified cell lysates were normalized for total protein concentrations by the Bradford protein assay (Bio-Rad). To reverse BMP7 inhibition of telomerase, green fluorescent protein (GFP)-hTERT was expressed by transfection with pEGFP-C2-hTERT plasmid, with pEGPF-C2 plasmid as control. Cell transfection was conducted using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instruction. After 24 h of transfection, cells positive for GFP were isolated by fluorescence-activated cell sorting, cultured, and incubated with BMP2, 4, 5, 6, or 7 for different periods of time and analyzed in Western blotting, semiquantitative reverse transcription-PCR (RT-PCR) for gene expressions, telomerase activity assay, and cell death analysis, as indicated in individual experiments.
FACS. GFP-transfected cells were sorted using FACSAria flow cytometer (BD Biosciences). The GFP-positive cells were reseeded into 6-well plates at a density of 0.2 x 106 cells/mL in DMEM plus 10% FBS including Gentamicin antibiotics (Pfizer). For apoptosis analysis, after treatment of cells as indicated in individual experiments, cells were dislodged from tissue culture plates using 0.5M EDTA for 5 min at 37°C and incubated with annexin-V-FLUOS conjugate (Roche Diagnostic) and propidium iodide (PI; Sigma) for 15 min at room temperature in an incubation buffer that facilitates binding per the manufacturers' instructions. The cells were then analyzed using FL-2 and FL-3 channel, respectively. Percentages of stained apoptotic cells were determined using a FACSCalibur flow cytometer (BD Biosciences). An acquisition gate was set to include
20,000 of the centrally located cells for each sample acquisition using linear forward scatter versus linear side scatter. This acquisition strategy resulted in
40,000 ungated events being included for each sample analysis. Dot-plot integration was determinate from the background fluorescence using unstained HeLa cells. This integration cursor placement remained unchanged when stained HeLa cells were analyzed.
Preparation of protein extracts and Western blotting. These procedures were described previously (30). Briefly, tumor cells were treated by CHAP lysis buffer, including protein inhibitors (Roche Diagnostic), at 4°C and homogenized immediately. The lysates were incubated for 10 min on ice and then centrifuged for 45 min at 5,000 x rpm, then centrifuged again for 30 min at 13,000 rpm. The supernatants were collected and stored at –80°C. Extracted proteins (
25 µg) in SDS sample buffer were boiled and electrophoresed on a 10% SDS-polyacrylamide gel and electroblotted onto a pre-wet nitrocellulose membrane (Bio-Rad Laboratories). The blotted nitrocellulose membrane was blocked in PBS containing 5% skim milk and 0.02% Tween 20, and probed with antibodies as indicated in individual experiments at 4°C overnight. The blots were developed using enhanced chemiluminescence Western blotting detection system (Amersham Biosciences).
RNA isolation and gene expression analysis. As previously described (30), total RNA was extracted by TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The RNA (1 µg) was transcribed by oligo(dT) and ThermoScript Reverse Transcriptase (Invitrogen) in a volume of total 21 µL. Contaminants were removed from the samples by Rnase H treatment, according to manufacturer's instruction (Invitrogen). Linear amplification for semiquantitative PCR was performed using ThermoScript RT-PCR kit following the manufacturer's instruction (Invitrogen), for 25 to 35 cycles of 30 s at 72°C as the optimized annealing temperature and 64°C extension. Primers specific for different genes were as follows: hTERT (5'-CCACCTTGACAAAGTACAG-3') and (5'-CGTCCAGACTCCGCTTCAT-3'), and Actin (5'-GCTCGTCGTCGACAACGGCTC-3') and (5'-CAAACATGATCTGGGTCSTCTTCTC-3'). Actin was used as control. PCR produces were mixed with 6x loading dye (30% glycerol, 0.5 mol/L EDTA, and Bromophenol Blue) and run on 1.5% Agarose gel, visualized in the presence of ethidium bromide, photographed in a gel 1000 UV documentation system (Bio-Rad), and analyzed by densitometry.
Telomerase activity assay. Telomerase activity was determined by TRAP as described previously (36). Briefly, cells treated with different reagents were washed and lysed by detaching and passing the cells though a 261/2G needle attached to a 1-mL syringe in prechilled TRAP lysis buffer. Equal amounts of telomerase protein extract (0.4 µg) were incubated with telomeric DNA substrate and deoxynucleotide triphosphate, and newly synthesized telomeric DNAs were observed after PCR using specific telomeric DNA primers and [
-32P]ATP (Amersham Biosciences), polyacrylamide slab gel electrophoresis, and autoradiography. As an internal control of the PCR and loading, the primers NT (ATCGCTTCTCGGCCTTTT) and TSNT (AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT) were included in the reaction.
Telomere length analysis. For telomeres in cultured cells, metaphase spreads from cycling HeLa cells that were treated with or without BMP7 (30 ng/mL, 15 h) thrice per week for 2 wk were generated using standard laboratory protocols. The slides of metaphase cells or tumor sections were fixed in 4% formaldehyde before treatment with acidified 1% pepsin solution, and hybridized with the probe solution [0.3 µg/mL Cy3-conjugated [CCCTAA]3 PNA probe (Panagene), 70% formamide, 20 mmol/L Tris-HCl (pH 7.0), 1% bovine serum albumin (BSA)]. Washing was conducted in PBS/Tween 20 with one high stringent wash at 57°C. DNA was counterstained with 4',6-diamidino-2-phenylindole, visualized, and captured using Nikon Eclipse TE2000 microscope, Plan Fluor x40 objective, DS-5MC CCD camera, and NIS-Elements F 2.20 software (Nikon). Telomere images were captured with a Plan Fluor x100 oil emersion objective, and individual telomere fluorescence was integrated using spot IOD analysis in the TFL-Telo 2.2 program (gift from Dr. Peter Lansdorp, Vancouver, Canada; ref. 37). Images from at least 13 metaphase spreads from each data point were quantified before assembly of data in a standard spreadsheet program. At least 50 cell nuclei from each condition were analyzed.
Tumor cell growth analysis in soft agar. Tumor cell colonies were grown in soft agar to assess the effects of BMP7 on tumor growth in vitro. Two milliliters of mixture of 2x DMEM containing 20% FBS were used to make 0.5% agar (base layer) with or without BMP7 in a 35-mm culture dish or 6-well plate. On top of the base layer, a mixture of serum supplemented medium and 0.35% agar (2 mL) containing 2,500 HeLa cells in the presence or absence of BMP7 (100 ng/mL or as indicated; top layer) was added. The dishes were kept in tissue culture incubator at 37°C and 5% CO2 for 14 d to allow for colony formation and growth. All assays were performed in triplicates. The colony assay results were photographed or scanned after the plates were stained with methylthiazolyldiphenyl-tetrazolium (MTT).
Tumor xenografting and treatment procedure. HeLa cells were xenografted in female nude mice (BALB/c Nude; Animal Resources Centre ARC). Cultured monolayer cells were detached by trypsinization, washed in PBS, and counted. Approximately 10 x 106 cells were resuspended in 0.1 mL PBS and inoculated s.c. in the flank of the mice. Twenty-four hours after inoculation, BMPs and other reagents prescribed as indicated in individual experiments were administered into the xenografts on every second day. The development of xenograft tumors was measured with Vernier callipers before each treatment. The animals were sacrificed by carbon dioxide asphyxiation when tumor growth in the controls reached 20 mm in diameter. Immediately after culling, the tumors were removed, measured, snap-frozen in liquid nitrogen, and stored at –80°C for further analyses. The mice were maintained under specific pathogen-free conditions at constant temperature (
22°C) and humidity (
40%). Sterilized food and water were given ad libitum.
Tumor tissue sectioning and staining. Freshly dissected tumor samples were embedded in ornithine carbamyl transferase compound and frozen using isopentane cooled with liquid nitrogen. Five-micrometer fresh-frozen sections were prepared and used to stain for the Ki67 antigen, a marker of cell proliferation. Sections were fixed in 4% paraformaldehyde/10% sucrose, washed once in PBS, and blocked with 5% BSA (Fraction V; Sigma) for 30 min. Sections were incubated with polyclonal rabbit anti-Ki67 antibodies (ab15580; Abcam) at 4°C overnight at a 1:400 dilution. Primary antibody was detected with Cy3-conjugated goat anti-rabbit antibodies (Chemicon) for 90 min at a 1:200 dilution. Nuclei were stained with 0.5 µg/µL Hoechst 33258 (Sigma). The staining was visualized by fluorescence microscopy. Five random images within the tumor area were analyzed in 3 sections,
5 µm apart, for each treatment group.
Statistical analysis. Data were analyzed using Student's t tests and a P value of <0.05 was considered statistically significant.
 |
Results
|
|---|
BMP7 induces telomerase inhibition and telomere shortening in cultured cancer cells. To investigate a potential role of the BMP family in telomerase activity, we examined effects of BMP2, BMP4, BMP5, BMP6, and BMP7 by spiking the medium of cancer cell cultures with purified recombinant human cytokines. Incubation of human cervical cancer HeLa cells with different concentrations of BMP7 for 48 hours resulted in significant inhibition of telomerase activity (Fig. 1A
). The maximal inhibition was
85% inhibition of telomerase activity, achieved with the median inhibitory concentration (IC50) of BMP7 of 8 ± 0.6 ng/mL and the maximal inhibitory concentration of 35 ± 1.4 ng/mL (n = 3; Fig. 1B). Incubations of the cells with BMP2, BMP4, BMP5, or BMP6 showed no significant inhibitory effect on telomerase activity (data not shown). In the time course studies, BMP7 (10 ng/mL) induced telomerase inhibition in 24 hours of the treatment for
3 days (Fig. 1B). To determine the inhibitory effect on telomerase in another cancer cell type, we tested human breast cancer PMC42 cells with different concentrations of BMP7. As shown in Fig. 1C, BMP7 induced significant inhibition of telomerase activity in a dose-dependent manner in PMC42 cells. To verify that the inhibition of telomerase activity in HeLa and breast cancer cells was at the levels of gene expression of hTERT, we measured hTERT mRNA by semiquantitative RT-PCR. As shown in Fig. 1D, BMP7 induced a significant down-regulation of hTERT gene expression in both HeLa and PMC42 cells. In addition, we noted that BMP7 also induced a significant down-regulation of c-myc gene expression (Fig. 1D). The inhibition of c-myc gene expression was
80% of control, and the inhibition of hTERT gene expression was
70% of the control (Fig. 1D).

View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 1. BMP7 induces inhibition of telomerase activity in cultured cancer cells. A, concentration-dependent inhibition of telomerase activity. HeLa cells were incubated with different concentrations of BMP7 as indicated for 24 h in cell cultures, and then subjected to telomerase activity analysis. Telomerase activity was determined by measuring newly synthesized telomeric DNA as described in the Materials and Methods. Telomeric DNA ladders and an internal loading control are indicated. Lanes 1 and 2, interexperimental positive (P) and negative (N) controls, respectively. B, quantitative data of BMP7 concentration- and time-dependent inhibition of telomerase activity in HeLa cells. Cells were treated for 24 h in the concentration-dependent experiments, or treated with BMP7 at 30 ng/mL for various time periods as indicated in the time course studies. Telomeric DNAs resolved gel electrophoresis and autoradiography were scanned and presented as percentages of the values in nontreated controls. Columns, mean from three determinations; bars, SD. C, effects of BMP7 on telomerase activity in PMC42 cells. PMC42 cells were incubated with BMP7 for 24 h at the indicated concentrations followed by telomerase activity analysis. Telomere DNA produced and internal control are indicated. D, semiquantitative RT-PCR analysis of hTERT and c-myc gene expressions. HeLa and PMC42 cells treated with BMP7 (30 ng/mL, 24 h) were extracted for mRNA and semiquantitative RT-PCR as described in the Materials and Methods. The levels of hTERT and c-myc (top) were quantified as ratios to actin; columns, mean from three similar experiments; bars, SD. *, significant difference compared with nontreated control (P < 0.01).
|
|
To determine the effect of BMP7 on telomeres, we treated HeLa cells with 30 ng/mL of BMP7 for 15 hours each time on every second day for 2 weeks. The pulsatile treatments of cultured HeLa cells with BMP7 resulted in a sustained telomerase inhibition and significant shortening of telomeres as measured by quantitative fluorescence in situ hybridization (Q-FISH), using a specific telomeric DNA probe in cell metaphase spreads. As shown in Fig. 2A
, BMP7 treatments of cultured HeLa cells caused a marked shift of the telomere fluorescence peak compared with the control. The size of telomeres in the control cells was ranged with a major peak of >100 frequencies between
300 and
1,200 fluorescence unit. In contrast, the telomeres in the BMP7-treated cells were shown as a major peak with a relatively narrow range exhibiting between 100 and 1,100 fluorescence unit. The highest frequency of telomere fluorescence in control cells occurred at 800 to 900 fluorescence units, whereas the highest frequency of telomere fluorescence in BMP7-treated cells occurred at 500 to 600 fluorescence units showing significantly shortened telomeres compared with the control (Fig. 2A). Analyzing the mean telomere length in control and BMP7-treated cells showed that the mean telomere length in the BMP7-treated group could be
25% shorter than that in the controls (Fig. 2B). The fluorescence micrographs in Fig. 2C showed typical images of telomere fluorescence (yellow dots) in different sizes at the ends of chromosomes (blue) between control (left) and BMP7-treated (right) HeLa cells.

View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 2. BMP7 induces telomere shortening in cervical cancer cells. A, effect of BMP7 on telomere length in HeLa cells. Cells were treated with or without BMP7 (30 ng/mL) for 15 h followed by replacement with fresh medium on every second day for 2 wk. Telomeres were determined by Q-FISH, and the distributions of telomere length are presented by fluorescence intensity versus frequencies. B, histograms of mean telomere fluorescence intensities (±SE) in control and BMP7-treated cells. C, illustrative micrographs of fluorescence-labeled telomeres in metaphase spreads.
|
|
BMP7 induces cancer cell death by a mechanism largely dependent on hTERT gene repression. To determine the functional consequence of BMP7-induced telomerase inhibition and telomere shortening, we examined the changes in cell number and apoptotic death in the cell cultures treated with or without different cytokines over a time course of several days. As shown in Fig. 3A
, whereas the cells underwent population doubling in the control group, a single-dose treatment of HeLa cells with BMP7 (10 ng/mL) resulted in a marked reduction of total cell number. The reduction of cell number in the cell cultures treated with BMP7 was
50% on each day of the controls treated with diluent, BMP2, BMP4, BMP5, or BMP6, showing a complete arrest of cell population doubling by the presence of BMP7 (Fig. 3A). Treatment of the cells with different concentrations of BMP7 for 24 hours showed a concentration-dependent reduction of cell numbers (data not shown). To determine if BMP7 induces cancer cell apoptosis, we examined HeLa treated with or without BMP7 for the apoptotic markers of Annexin V and PI staining by FACS. As shown in Fig. 3B, a single dose of BMP7 treatment resulted in a significantly increase in HeLa cell apoptosis compared with controls (7% versus 17%).

View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 3. BMP7-induced cancer cell apoptosis requires hTERT gene repression. A, inhibition of cancer cell proliferation by BMP7. HeLa cells were incubated with or without 30 ng/mL of BMP7, BMP6, BMP5, BMP4, or BMP2 for different periods of time as indicated. Cell numbers were counted in 20 µL at each time when cells were subcultured or terminated in Coulter counter (Beckman Coulter; Z Series). *, significant difference from the nontreated control (P < 0.05). B, effects of BMP7 on apoptosis. HeLa cells transfected with empty plasmid, hTERT shRNA, or hTERT wild-type gene expression plasmid for 24 h and then incubated with or without BMP7 (10 ng/mL) for further 24 h, as indicated. Cells were stained with Annexin V and PI, and analyzed by FACS. C, effects of gene expression of hTERT or hTERT shRNA on BMP7-induced HeLa cell death. Cells transfected with pEGFP, pEGFP-hTERT, or pEGFP-hTERT shRNA for 24 h were isolated by FACS sorting and incubated with BMP7 (10 ng/mL) or diluent as indicated for 24 h. Apoptosis was analyzed by PI staining in FACS. The data were from one of three similar experiments. D, effects of BMP7 in telomerase-negative cell lines. GM847, Saos2, and HeLa cells were incubated in duplicate with different concentrations of BMP7 for 48 h.
|
|
To investigate if BMP7-induced cell death is a consequence of hTERT gene repression and telomerase inhibition, we analyzed the effect of hTERT gene expression on BMP7-induced cell death in HeLa cell cultures. Underexpression of hTERT with hTERT shRNA for 48 hours mimicked the cell killing effect of BMP7 (Fig. 3B), whereas overexpression of hTERT for 24 hours before BMP7 treatment inhibited subsequent BMP7-induced cell death (Fig. 3B), suggesting that the proapoptotic effect of BMP7 is mediated in a significant part by hTERT repression. To further attest the role of hTERT in the BMP7-induced cell death, we transfected HeLa cells with GFP-hTERT, GFP-hTERT shRNA, or GFP-only gene expression plasmids, then isolated the GFP-positive transformants by FACS and treated the cells with BMP7 (10 ng/mL) for 24 hours. In these homogenously transfected cell cultures, we found that the expression of GFP-hTERT significantly decreased the levels of cell death induced by BMP7 (from 10-22% versus from 10-17%; Fig. 3C), corroborating that hTERT repression is required to a significant degree in BMP7-induced cell death. Consistently, down-regulation of hTERT with GFP-hTERT shRNA increased cell death above basal levels (Fig. 3C). Consistent with a significant role of telomerase inhibition in mediating BMP7-induced apoptosis, BMP7 did not induce significant cell death in the telomerase-negative GM847 and Saos2 cell cultures (Fig. 3D). Verification of BMP7 receptors by Western blotting with specific antibodies confirmed the presence of both BMPR1A and BMPR2 receptors in Saos2 and HeLa cell lines, although BMPR1A was not detectable in GM847 cells (data not shown).
BMP7 inhibits tumor growth with hTERT gene repression and telomere shortening in mouse xenograft tumors. To investigate if BMP7 inhibits tumor growth, we examined the effect of BMP7 on tumor cell anchorage–independent growth in soft agar assays. As shown in Fig. 4A
(left), numerous tumor colonies grew from the HeLa cell suspension under basal conditions. In the presence of BMP7, however, there was a dramatic inhibition of tumor colony formation and growth, resulting in <15% colonies of the control (Fig. 4A). The inhibition was concentration dependent, with the IC50 and maximal inhibition concentrations being 4 and 20 ng/mL, respectively (Fig. 4A, right). To attest the effect of BMP7 on tumor growth in vivo, we exploited the xenograft tumor model in immune-deficient nude mice and carried out intratumor injection of different concentrations of BMP7 on every second day for 2 weeks. BMP7 markedly inhibited tumor growth compared with the controls (Fig. 4B). Significant tumor growth inhibition was observed after the first one or two injections of 10 ng/mL of BMP7, with maximal inhibition observed after three injections (Fig. 4B). Inhibition was concentration dependent, with the IC50 being
10 ng/mL and maximal inhibitory concentration of 30 ng/mL of BMP7 (Fig. 4C). The effective concentrations were comparable with that inducing telomerase inhibition (Fig. 1A) and inhibiting thymidine incorporation in human myeloma cells (12). In 2 weeks of the treatment, BMP7 induced a maximal tumor growth inhibition by
75% of the controls (Fig. 4C), whereas no significant inhibitory effect was observed on the tumors receiving BMP2, BMP4, BMP5, or BMP6 under the same experimental conditions (Fig. 4B).

View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4. BMP7 inhibition of tumor growth. A, micrograph of BMP7 suppression of tumor growth in soft agars. HeLa cells (3 x 106) in 0.35% soft agar suspension were incubated with or without BMP7 at 10 ng/mL (left) or different concentrations (right) for 7 d. Tumor colonies were observed after staining with MTT. Columns, mean from four different determinations; bars, SD. B, effects of different BMPs on xenograft tumor growth in mice. HeLa cells (3 x 106) were inoculated in nude mice s.c. Different BMPs (10 ng/mL in 50 µL PBS) were injected in each xenograft 24 h after inoculation and then on every second day for 2 wk. Tumor growth was measured before each injection. Columns, mean from multiple experiments (22 animals in PBS groups, 24 animals in BMP7-treated groups, and 4 to 8 animals in groups receiving other BMPs); bars, SD. *, significant difference from PBS control with P < 0.01. C, dose-dependent effect of BMP7 on xenograft tumor growth in mice. BMP7 of different doses was administered as indicated on every second day for 2 wk. Columns, mean from four animals in each group; bars, SD. D, expression of hTERT reverses BMP7-induced tumor growth inhibition. Empty plasmid, hTERT shRNA expression plasmid, or hTERT wild-type gene expression plasmid was intratumor injected 1 d after tumor inoculation and continued on every second day for 2 wk. One day after injections of empty plasmid and hTERT wild-type gene expression plasmid, and 2 d after HeLa cell inoculation, BMP7 (10 ng/mL) was administered, which was continued on every second day for 2 wk. Columns, mean from four animals in each treatment group; bars, SD. *, significant differences from that in PBS control.
|
|
To determine the intermediate role of hTERT gene repression in the BMP7-induced tumor growth inhibition, we carried out underexpression and overexpression of hTERT in the xenograft tumors and determined the effect of BMP7 in different backgrounds of hTERT gene expression on tumor growth. Significant inhibitory effect on tumor growth was observed in the animals treated by intratumor injection of the hTERT shRNA expression plasmid (Fig. 4D). Overexpression of wild-type hTERT has no significant effect on tumor growth in the cohort receiving intratumor injection of hTERT expression plasmid. However, overexpression of hTERT significantly compromised the BMP7-induced inhibition of tumor growth, reversing tumor growth inhibition from 25% back to 70% to 80% of the control after 2 weeks of treatments (Fig. 4D). Examinations of telomerase activity in the tumors treated with or without BMP7 showed that telomerase activity was almost completely inhibited in the tumor tissues treated with BMP7 for 2 weeks, in contrast to the controls and other groups receiving treatments with BMP2, BMP4, BMP5, or BMP6 (Fig. 5A and B
). To determine altered gene expressions, we found that BMP7 treatment rendered a marked inhibition of the endogenous hTERT gene expression after 2 weeks of treatment (Fig. 5C and D). In addition, BMP7 treatment also induced a significant inhibition of the oncogene c-myc gene expression (Fig. 5C and D), suggesting that BMP7 induces the repression of the hTERT gene through a transcription-dependent mechanism involving c-myc gene repression (30, 33). Furthermore, corresponding with a BMP7-triggerd deregulation of telomeres and its associated DNA damage response, we observed significant increases in the levels of p53 and p16 tumor suppressors in the tumors treated with BMP7 (Fig. 5C and D). The increases of p53 and p16 were significant compared with the control, reflecting an activation of the cell cycle checkpoints and arrest of the cell cycle (Fig. 5D).

View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 5. BMP7 induces telomerase inhibition, hTERT gene repression, and p53 and p16 gene activation in mouse xenograft tumors. A, effects of BMPs on telomerase activity in tumors. Tumors were treated with or without different BMPs (10 ng/mL) on every second day for 2 wk. Telomerase activity in the tumors was measured by TRAP. B, telomerase activity quantified by densitometry. Columns, mean (n = 3); bars, SD. Telomere DNA and internal control are indicated. C, altered gene expressions of hTERT, c-myc, and p53 and p16 in the xenograft tumors treated with BMP7. Quantitative data of gene expressions of c-myc, hTERT, p53, p16, and actin in tumors treated with and without BMP7 as indicated. Data were obtained by densitometry; columns, mean from three determinations; bars, SD. D, semiquantitative RT-PCR determination of hTERT and c-myc, and Western blotting for p53 and p16. The results are representatives of multiple experiments.
|
|
Examination of telomeres in the tumor tissues showed that the average telomere length in the tumors treated with BMP7 for 2 weeks was significantly shorter than that in the controls (Fig. 6A and B
). The shortening of telomeres induced by the pulsatile treatment with BMP7 for 2 weeks was 25% to 30% of the controls. On the contrary, overexpression of hTERT resulted in lengthened telomeres to
130% of the control (Fig. 6A and B) in association with a significant reversal of BMP7-induced tumor growth arrest (Fig. 4D). Consistent with a functional consequence of telomere shortening, we observed a significant decrease of cell proliferation as indicated by Ki67 staining in BMP7-treated tumors. As shown in Fig. 6C and D, BMP7 elicited an inhibition of cell proliferation by
60% as estimated in Ki67 staining on tumor tissue sections. These in vivo findings from the xenograft tumors mirrored the findings from cell culture studies, demonstrating that BMP7 triggered an intracellular signaling pathway leading to repressed gene expressions of c-myc and hTERT, increased gene expressions of cell cycle checkpoints, inhibition of telomerase activity, shortening of telomeres, and cancer cell apoptosis.

View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 6. BMP7 induces telomere shortening and tumor cell growth arrest in mouse xenograft tumors. A, BMP7 induces telomere shortening in tumors. Xenograft tumors in mice were treated on every second day for 2 wk. The tumors were sectioned and examined for telomeres by Q-FISH (Materials and Methods). Red dots, illustrative micrographs of Q-FISH with merged images showing telomeres; blue dots, DNA. B, quantitative histogram of the mean telomere fluorescence intensity. Columns, mean from at least 50 cells chosen randomly from each of the four conditions indicated; bars, SE. P values indicate the levels of significant differences between the means of treated groups and control. C, decreased Ki67 as cell proliferation marker in xenograft tumors treated with BMP7. Sections from control and BMP7-treated tumors were fixed and incubated with Ki67 antibodies (red) and were stained for nuclei with Hoechst 33258 (blue). D, quantitative analysis of cell proliferation by counting Ki67 positively cells from 15 views of 3 sections in each group. Columns, mean of percentage in total cells; bars, SE.
|
|
 |
Discussion
|
|---|
The maintenance of telomeres is critical for cancer cell proliferation particularly as telomeres are already very short in cancer cells (21, 24). Inhibition of telomere maintenance offers an important mechanism to inhibit cancer cell proliferation. In this study, we show that the cytokine BMP7 triggers an inhibition of telomere maintenance and cervical cancer cell growth arrest in vitro and in tumor xenografts. A single application of recombinant BMP7 produces a significant inhibition of telomerase activity critical in telomere maintenance in cultured cervical cancer HeLa cells. Continuous applications of BMP7 on every second day for 2 weeks in HeLa cell cultures or xenograft tumors result in a sustained depression of telomerase activity and shortening of telomeres. Consistently, BMP7 induces a gene expression pattern of decreased hTERT and c-myc, and increased p16 and p53. Furthermore, BMP7 induces inhibition of cancer cell anchorage–independent growth in soft agar and xenograft tumor growth. These findings suggest that telomere homeostasis is subject to regulation by extracellular cytokines in which BMP7 plays a significant role in eliciting a negative regulation of telomere maintenance and cell proliferative capacity in cancer. Furthermore, our data also suggest that BMP7 has a potential utility in anticancer effect by targeting cancer cell telomere maintenance.
The specificity of BMP7-induced inhibition of telomerase activity, telomere maintenance and cancer cell proliferation was shown by testing different BMPs. The dose-dependent effect of BMP7, with an effective concentration within a physiologically relevant range (11, 38, 39), supports a specific effect of BMP7 mediated by BMP7 receptors on tumor cell surface. Time course studies showing that BMP7 inhibition of telomerase activity occurs in 24 hours of treatment further suggest that BMP7 inhibits telomerase activity by modifying specific programs of gene expression in the tumor cells. We identify that the effect of BMP7 on cancer cell apoptosis is mediated by a mechanism involving repression of the hTERT gene and inhibition of telomerase activity. Underexpression of hTERT mimics the cell killing effect of BMP7, whereas overexpression of hTERT significantly inhibits the BMP7-induced cell death. Although future studies are required to investigate the mechanisms underlying BMP7-induced hTERT gene repression and telomere shortening, the findings that c-myc is down-regulated in association with hTERT down-regulation suggest that repression of c-myc contributes to the repression of the hTERT gene induced by BMP7.
Previous studies show that BMP7 induces apoptosis of myeloma cells (12) and prostate cancer cells (13, 18). Consistently, our studies show that BMP7 also induces cervical cancer cell apoptosis. In addition, we show for the first time that BMP7 inhibits cervical tumor growth in mice. Our in vivo findings in cervical cancer cells are consistent with recent studies showing BMP7 antitumor effect in breast cancer (19) and prostate cancer (19). Furthermore, we have found that BMP7 inhibits telomerase activity and induces telomere shortening as a fundamental mechanism in BMP7-induced cell death. In line with the recent findings that BMP7 maintains epithelial cell phenotypes, and inhibits epithelial-mesenchymal transition and cancer cell metastasis (16, 17, 19), our data suggest that BMP7 serves a function to inhibit cancer cell proliferation by inducing intracellular signaling to counteract mitogenic stimulation of telomerase activity by factors such as c-myc. Endogenous BMP7 produced in cancer cells may thus be a protective mechanism against oncogenic development, and reinforcement with exogenous recombinant BMP7 produces an imbalance in favor of BMP7 predominance by counterbalancing the actions of oncogenic growth factors and cytokines in extracellular microenvironment of cancer. BMP7-induced inhibition of telomerase activity and shortening of telomeres may therefore represent a powerful mechanism to intercept the process of immortalization of neoplastic cells that use telomerase to maintain telomeres. To the cancer cells that adopt alternative mechanisms to maintain telomeres, BMP7 seems ineffective as we show that BMP7 does not induce significant cell death of Saos2 cells that express BMP7 receptors and are telomerase negative. Because BMP7 inhibition of prostate cancer cell proliferation is also dependent on the subtypes of derived cell lines (18), it would be interesting to determine if cells that respond differently to BMP7 without undergoing apoptosis assume a different mechanism to stabilize telomeres during continuous proliferation. However, our findings that constant presence of high levels of BMP7 results in sustained telomerase inhibition and telomere shortening illustrate a novel model in cytokine therapeutic intervention of cancer development through targeting telomerase maintenance of telomeres.
It is currently thought that deregulation of telomeres instigates rapid cell death via mechanisms including telomere decapping and DNA damage response. Our observation that BMP7 induces telomerase inhibition and telomere shortening in association with imminent cancer cell death are consistent with the recent findings that inhibition of telomerase induces a rapid cancer cell death (40, 41). Our findings that BMP7 induces hTERT repression–dependent inhibition on tumor growth are also consistent with recent reports that inhibition of telomerase induces telomere shortening and tumor growth arrest (42, 43). In support of telomeric DNA damage response, we show that BMP7 induces increased p16 and p53 cell cycle checkpoint activities. Critical in tumor cell aging and death (44, 45), increased p16 and p53 activities have previously been shown to be involved in coupling telomere deregulation with cell senescent and apoptotic response (46, 47). Thus, BMP7-induced cancer cell death may be prompted by a series of interchanges including telomerase inhibition, telomere shortening, telomere-associated DNA damage responses, and subsequent cell senescence and apoptosis (48–50). In summary, our data show a novel mechanism of BMP7-negative regulation of telomere maintenance and cell proliferation in cancer by a mechanism of hTERT gene repression and telomerase inhibition in vitro and in vivo. Our data suggest that telomeres undergo continuous remodeling, which can be reprogramming by defined combinations of extracellular factors, with BMP7 serving as a major negative regulator. Further studies should unveil a complete picture of extracellular regulation of telomere remodeling by various factors in cancer and other highly proliferative cells such as stem cells.
 |
Disclosure of Potential Conflicts of Interest
|
|---|
No potential conflicts of interest were disclosed.
 |
Acknowledgments
|
|---|
Grant support: National Health and Medical Research Council of Australia, Australia Research Council, and Cancer Council of Victoria, Australia.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Peter Lansdorp for the TFL-Telo 2.2 software program for telomere analysis.
Received 4/ 9/08.
Revised 8/15/08.
Accepted 8/27/08.
 |
References
|
|---|
- Patel SR, Dressler GR. BMP7 signaling in renal development and disease. Trends Mol Med 2005;11:512–8.[CrossRef][Medline]
- Milan M. Sculpting a fly leg: BMP boundaries and cell death. Nat Cell Biol 2007;9:17–8.[CrossRef][Medline]
- Attisano L, Wrana JL. Signal transduction by the TGF-β superfamily. Science 2002;296:1646–7.[Abstract/Free Full Text]
- Massague J, Seoane J, Wotton D. Smad transcription factors. Genes Dev 2005;19:2783–810.[Abstract/Free Full Text]
- Foletta VC, Lim MA, Soosairajah J, et al. Direct signaling by the BMP type II receptor via the cytoskeletal regulator LIMK1. J Cell Biol 2003;162:1089–98.[Abstract/Free Full Text]
- Wen Z, Han L, Bamburg JR, Shim S, Ming GL, Zheng JQ. BMP gradients steer nerve growth cones by a balancing act of LIM kinase and Slingshot phosphatase on ADF/cofilin. J Cell Biol 2007;178:107–19.[Abstract/Free Full Text]
- Lu M, Lin SC, Huang Y, et al. XIAP induces NF-
B activation via the BIR1/TAB1 interaction and BIR1 dimerization. Mol Cell 2007;26:689–702.[CrossRef][Medline] - Qiu T, Grizzle WE, Oelschlager DK, Shen X, Cao X. Control of prostate cell growth: BMP antagonizes androgen mitogenic activity with incorporation of MAPK signals in Smad1. EMBO J 2007;26:346–57.[CrossRef][Medline]
- Alarmo EL, Rauta J, Kauraniemi P, Karhu R, Kuukasjarvi T, Kallioniemi A. Bone morphogenetic protein 7 is widely overexpressed in primary breast cancer. Genes Chromosomes Cancer 2006;45:411–9.[CrossRef][Medline]
- Rothhammer T, Wild PJ, Meyer S, et al. Bone morphogenetic protein 7 (BMP7) expression is a potential novel prognostic marker for recurrence in patients with primary melanoma. Cancer Biomark 2007;3:111–7.[Medline]
- Grijelmo C, Rodrigue C, Svrcek M, et al. Proinvasive activity of BMP-7 through SMAD4/src-independent and ERK/Rac/JNK-dependent signaling pathways in colon cancer cells. Cell Signal 2007;19:1722–32.[CrossRef][Medline]
- Ro TB, Holt RU, Brenne AT, et al. Bone morphogenetic protein-5, -6 and -7 inhibit growth and induce apoptosis in human myeloma cells. Oncogene 2004;23:3024–32.[CrossRef][Medline]
- Miyazaki H, Watabe T, Kitamura T, Miyazono K. BMP signals inhibit proliferation and in vivo tumor growth of androgen-insensitive prostate carcinoma cells. Oncogene 2004;23:9326–35.[CrossRef][Medline]
- Beck SE, Jung BH, Del Rosario E, Gomez J, Carethers JM. BMP-induced growth suppression in colon cancer cells is mediated by p21(WAF1) stabilization and modulated by RAS/ERK. Cell Signal 2007;19:1465–72.[CrossRef][Medline]
- Jena N, Martin-Seisdedos C, McCue P, Croce CM. BMP7 null mutation in mice: developmental defects in skeleton, kidney, and eye. Exp Cell Res 1997;230:28–37.[CrossRef][Medline]
- Buijs JT, Rentsch CA, van der Horst G, et al. BMP7, a putative regulator of epithelial homeostasis in the human prostate, is a potent inhibitor of prostate cancer bone metastasis in vivo. Am J Pathol 2007;171:1047–57.[Abstract/Free Full Text]
- Zeisberg EM, Tarnavski O, Zeisberg M, et al. Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat Med 2007;13:952–61.[CrossRef][Medline]
- Yang S, Zhong C, Frenkel B, Reddi AH, Roy-Burman P. Diverse Biological Effect and Smad Signaling of Bone Morphogenetic Protein 7 in Prostate Tumor Cells. Cancer Res 2005;65:5769–77.[Abstract/Free Full Text]
- Buijs JT, Henriquez NV, van Overveld PG, et al. Bone morphogenetic protein 7 in the development and treatment of bone metastases from breast cancer. Cancer Res 2007;67:8742–51.[Abstract/Free Full Text]
- Blackburn EH. Switching and signaling at the telomere. Cell 2001;106:661–73.[CrossRef][Medline]
- Xu L, Blackburn EH. Human cancer cells harbor T-stumps, a distinct class of extremely short telomeres. Mol Cell 2007;28:315–27.[CrossRef][Medline]
- Negrini S, Ribaud V, Bianchi A, Shore D. DNA breaks are masked by multiple Rap1 binding in yeast: implications for telomere capping and telomerase regulation. Genes Dev 2007;21:292–302.[Abstract/Free Full Text]
- Morrish TA, Garcia-Perez JL, Stamato TD, Taccioli GE, Sekiguchi J, Moran JV. Endonuclease-independent LINE-1 retrotransposition at mammalian telomeres. Nature 2007;446:208–12.[CrossRef][Medline]
- Shay JW, Wright WE. Telomerase therapeutics for cancer: challenges and new directions. Nat Rev Drug Discov 2006;5:577–84.[CrossRef][Medline]
- Hahn WC. Telomere and telomerase dynamics in human cells. Curr Mol Med 2005;5:227–31.[CrossRef][Medline]
- Holt SE, Wright WE, Shay JW. Regulation of telomerase activity in immortal cell lines. Mol Cell Biol 1996;16:2932–9.[Abstract]
- Li H, Pinto AR, Duan W, Li J, Toh BH, Liu JP. Telomerase down-regulation does not mediate PC12 pheochromocytoma cell differentiation induced by NGF, but requires MAP kinase signalling. J Neurochem 2005;95:891–901.[CrossRef][Medline]
- Kyo S, Inoue M. Complex regulatory mechanisms of telomerase activity in normal and cancer cells: How can we apply them for cancer therapy? Oncogene 2002;21:688–97.[CrossRef][Medline]
- Takakura M, Kyo S, Inoue M, Wright WE, Shay JW. Function of AP-1 in transcription of the telomerase reverse transcriptase gene (TERT) in human and mouse cells. Mol Cell Biol 2005;25:8037–43.[Abstract/Free Full Text]
- Li H, Xu D, Li J, Berndt MC, Liu JP. Transforming growth factor β suppresses human telomerase reverse transcriptase (hTERT) by Smad3 interactions with c-Myc and the hTERT gene. J Biol Chem 2006;281:25588–600.[Abstract/Free Full Text]
- Li H, Liu JP. Mechanisms of action of TGF-β in cancer: evidence for Smad3 as a repressor of the hTERT gene. Ann N Y Acad Sci 2007;1114:56–68.[CrossRef][Medline]
- Li H, Xu D, Toh BH, Liu JP. TGF-β and cancer: is Smad3 a repressor of hTERT gene? Cell Res 2006;16:169–73.[CrossRef][Medline]
- Hu B, Tack DC, Liu T, Wu Z, Ullenbruch MR, Phan SH. Role of Smad3 in the regulation of rat telomerase reverse transcriptase by TGFβ. Oncogene 2006;25:1030–41.[CrossRef][Medline]
- Fujiki T, Miura T, Maura M, et al. TAK1 represses transcription of the human telomerase reverse transcriptase gene. Oncogene 2007;26:5258–66.
- Lacerte A, Korah J, Roy M, Yang XJ, Lemay S, Lebrun JJ. Transforming growth factor-β inhibits telomerase through SMAD3 and E2F transcription factors. Cell Signal 2008;20:50–9.[CrossRef][Medline]
- Li H, Zhao LL, Funder JW, Liu JP. Protein phosphatase 2A inhibits nuclear telomerase activity in human breast cancer cells. J Biol Chem 1997;272:16729–32.[Abstract/Free Full Text]
- Rufer N, Dragowska W, Thornbury G, Roosnek E, Lansdorp PM. Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry. Nat Biotechnol 1998;16:743–7.[CrossRef][Medline]
- Ma T, Gutnick J, Salazar B, et al. Modulation of allograft incorporation by continuous infusion of growth factors over a prolonged duration in vivo. Bone 2007;41:386–92.[CrossRef][Medline]
- Simic P, Culej JB, Orlic I, et al. Systemically administered bone morphogenetic protein-6 restores bone in aged ovariectomized rats by increasing bone formation and suppressing bone resorption. J Biol Chem 2006;281:25509–21.[Abstract/Free Full Text]
- Li S, Crothers J, Haqq CM, Blackburn EH. Cellular and gene expression responses involved in the rapid growth inhibition of human cancer cells by RNA interference-mediated depletion of telomerase RNA. J Biol Chem 2005;280:23709–17.[Abstract/Free Full Text]
- Cao Y, Li H, Deb S, Liu JP. TERT regulates cell survival independent telomerase activity. Oncogene 2002;21:3130–8.[CrossRef][Medline]
- Djojosubroto MW, Chin AC, Go N, et al. Telomerase antagonists GRN163 and GRN163L inhibit tumor growth and increase chemosensitivity of human hepatoma. Hepatology 2005;42:1127–36.[CrossRef][Medline]
- Pallini R, Sorrentino A, Pierconti F, et al. Telomerase inhibition by stable RNA interference impairs tumor growth and angiogenesis in glioblastoma xenografts. Int J Cancer 2006;118:2158–67.[CrossRef][Medline]
- Xue W, Zender L, Miething C, et al. Senescence and tumour clearance is triggered by p53 restoration in murine liver carcinomas. Nature 2007;445:656–60.[CrossRef][Medline]
- Krimpenfort P, Ijpenberg A, Song JY, et al. p15Ink4b is a critical tumour suppressor in the absence of p16Ink4a. Nature 2007;448:943–6.[CrossRef][Medline]
- Smogorzewska A, de Lange T. Different telomere damage signaling pathways in human and mouse cells. EMBO J 2002;21:4338–48.[CrossRef][Medline]
- Jacobs JJ, de Lange T. p16INK4a as a second effector of the telomere damage pathway. Cell Cycle 2005;4:1364–8.[Medline]
- de Lange T. Protection of mammalian telomeres. Oncogene 2002;21:532–40.[CrossRef][Medline]
- Artandi SE, Chang S, Lee SL, et al. Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature 2000;406:641–5.[CrossRef][Medline]
- Denchi EL, de Lange T. Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature 2007;448:1068–71.[CrossRef][Medline]