Cancer Research 68, 10223, December 15, 2008. doi: 10.1158/0008-5472.CAN-08-1833
© 2008 American Association for Cancer Research
Experimental Therapeutics, Molecular Targets, and Chemical Biology |
I
B Kinase-
Regulates Endothelial Cell Motility and Tumor Angiogenesis
Laura M. DeBusk1,
Pierre P. Massion1,2 and
P. Charles Lin1,3,4
Departments of 1 Cancer Biology, 2 Medicine, 3 Radiation Oncology, and 4 Cell and Development Biology, Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, Tennessee
Requests for reprints: P. Charles Lin, Vanderbilt University Medical Center, 712 PRB, 2220 Pierce Avenue, Nashville, TN 37232. Phone: 615-936-1749; Fax: 615-936-1872; E-mail: Charles.lin{at}vanderbilt.edu.
 |
Abstract
|
|---|
The transcription factor nuclear factor-
B (NF-B) is constitutively activated in many types of cancers and has been implicated in gene expression important for angiogenesis, tumor growth, progression, and metastasis. Here, we show that the NF-B activator, IB kinase-
(IKK), but not IKKβ, promotes endothelial cell motility and tumor angiogenesis. IKK is elevated in tumor vasculature compared with normal endothelium. Overexpression of IKK in endothelial cells promoted cell motility and vascular tubule formation in a three-dimensional culture assay, and conversely, knockdown of IKK in endothelial cells inhibited cell motility, compared with controls. Interestingly, blocking NF-B activation totally abolished IKK-induced angiogenic function. Furthermore, using a tumor and endothelial cell cotransplantation model, we show that overexpression of IKK in endothelial cells significantly increased tumor vascular formation compared with controls, which contributed to increased tumor growth and tumor cell proliferation, and decreased tumor cell apoptosis. Collectively, these findings have identified a new function for IKK through the canonical NF-B pathway in tumor angiogenesis. [Cancer Res 2008;68(24):10223–8]
|
Introduction
|
|---|
Angiogenesis is a complex process requiring the regulation of many proangiogenic and antiangiogenic factors, as well as interplay between endothelial cells and other types of cells in the local environment. The activity of the transcription factor nuclear factor-B (NF-B) has long been associated with tumor growth and tumor angiogenesis. It plays important roles in cell survival, chemotaxis, and inflammation (1). Conversely, inhibition of NF-B activity impairs tumor growth in vitro and in vivo (2, 3). Evidence for the roles of NF-B in most aspects of tumor development and progression has been well-documented. For this reason, there is a worldwide push to develop NF-B inhibitors for clinical use.
NF-B is a ubiquitous, heterodimeric transcription factor that is sequestered in the cytosol by the IB proteins. Phosphorylation of IB by the inhibitor of B kinase family of proteins (IKK) leads to proteosome-mediated degradation, allowing NF-B nuclear translocation and subsequent activation of transcription. The IKK complex is composed of two enzymatic components, IKK and IKKβ, and one regulatory component, IKK
. Most studies on NF-B activation have been on the role of IKKβ in this process, as IKKβ has been shown to be sufficient for NF-B activation (4, 5). Until recently, IKK was considered a redundant protein because both IKK and IKKβ are similar in structure and function, and IKKβ is sufficient to activate NF-B (4, 5). However, recent studies indicate the role of IKK in cell signaling is distinct from that of IKKβ (6, 7). IKK can signal through an alternative NF-B activation pathway, whereby IKK is responsible for the processing of p100 to p52 (8). In addition, IKK has been shown to enter the nucleus upon activation and phosphorylate the H3 protein of the histone complex (9, 10). IKK also activates different sets of gene expression from IKKβ (6, 7). Therefore, it is quite likely that IKK could play a separate role from IKKβ.
In this study, we identify a new function of IKK in tumor angiogenesis. We showed that expression of IKK in endothelial cells promoted cell motility and vascular tubule formation in vitro through the canonical NF-B pathway. We also showed that IKK is up-regulated in tumor endothelium and promotes tumor angiogenesis and tumor growth in vivo.
|
Materials and Methods
|
|---|
Materials. Six- to 7-wk-old female Rag1 mice were purchased from Jackson Laboratories. The animals were housed in pathogen-free units at Vanderbilt University Medical Center, in compliance with Institutional Animal Care and Use Committee regulations. Age- and sex-matched mice were used. The adenoviral vectors directing expression of IKK, IKKβ, and IB were kindly provided by Dr. Fiona E. Yull (Vanderbilt University, Nashville, TN) and Dr. David A. Brenner (University of North Carolina at Chapel Hill, Chapel Hill, NC; ref. 11). Adenoviral vectors directing the expression of green fluorescent protein (GFP) and β-galactocidase were used as vector controls. The viral vectors were propagated in 293 cells and purified by CsCl gradients as described (12). Viral titers were determined by optical densitometry, and recombinant viruses were stored in 10% glycerol at –80°C (12). Human lung tumor tissues and surrounding normal lung tissues were collected from patients under surgery in Vanderbilt-Ingram Cancer Center, with written consent.
Cell culture. Cells were maintained in a humidified incubator with 5% CO2 at 37°C. Human umbilical vein endothelial cells (HUVEC) and human dermal microvascular endothelial cells (HDVEC) were purchased and cultured on gelatin-coated tissue culture dishes in EGM-2 medium (Cambrex). Primary endothelial cells were used between passage number 3 and 7. Lewis lung adenocarcinoma cells (LLC) were obtained from American Type Culture Collection, and grown on tissue culture plates in DMEM plus 10% fetal bovine serum and 1% antibiotics.
shRNAi. Pooled shRNAs (Sigma) for IKK (CCGGGCATCATAAGGAGTTGGTGTACTCGAGTACACCAACTCCTTATGATGCTTTT, CCGGCCAGATTATGAAGAAGTTGAACTCGAGTTCAACTTCTTCAT AATCTGGTTTTT, CCGGCCAGCCTCTCAATGTGTTCTACTCGAGTAGAACA CATTGAGAGGCTGGTTTTT, CCGGGCAAATGAGGAACAGGGCAATCTCGAG ATTGCCCTGTTCCTCATTTGCTTTTT, CCGGGCGTGCCATTGATCTATATAA CTCGAGTTATATAGATCAATGGCACGCTTTTT) or scrambled control were transfected into endothelial cells using RNAifect system (Qiagen). Protein expression and subsequent experiments were performed 24 h after transfection.
In vitro angiogenesis assays. The assays were performed as described (13). Briefly, for endothelial cell migration, cells were infected with adenoviral vectors expressing the gene of interest for 36 h and then plated on the upper chamber of Transwells (Costar). The chamber was placed in medium containing 25 ng/mL of recombinant vascular endothelial growth factor (VEGF; R & D). Cells were allowed to migrate for 5 h, followed by fixation in 10% buffered formalin and staining with crystal violet. Cells that had migrated to the underside of the filter were counted in 10 randomly selected x200 fields.
For endothelial cell tubule formation, cells were plated on top of Matrigel and incubated for 18 h at 37°C. Vascular branch crossings were counted in 10 randomly selected fields under microscopy. Each experiment was performed in triplicate and repeated thrice.
Analysis of tumor growth in vivo. The LLC and endothelial cell cotransplantation experiments were performed as described (14). Briefly, HUVECs were infected with adenoviral vectors directing the expression of either GFP or IKK. Twenty-four hours after infection, endothelial cells and LLC tumor cells were mixed together in growth factor–reduced Matrigel (BD Bioscience) and injected s.c. into the left hind flank of Rag1 mice. Tumor growth was measured every other day with calipers. Tumor volume was calculated as Length x Width2/2.
Histologic analysis. Immunohistochemical and immunofluorescent analyses were performed as described (15). Tumor tissue was harvested, embedded in optimal cutting temperature (OCT), and freshly frozen. Seven-micrometer sections were cut and stained with antibodies to detect IKK (Santa Cruz), pan CD31 for total vascular density, human specific CD31 antibody, and murine-specific CD31 antibody (Pharmingen). Apoptosis, cell proliferation, and hypoxia were determined by terminal deoxynucleotidyl-transferase–mediated dUTP nick-end labeling (TUNEL) assay (Chemicon), proliferating cell nuclear antigen (PCNA; Santa Cruz), and Hypoxyprobe-1 (Chemicon), respectively, according to manufacturers' protocols. 4',6-Diamidino-2-phenylindole (DAPI) staining was used to illuminate nuclei. The number of positive cells was counted in 10 randomly selected x200 fields under microscopy.
Western blot. Expression of IKK, IKKβ, and IB in tissue and cell samples was analyzed by Western blot using specific antibodies from Santa Cruz.
Statistics. Results are reported as mean ± SE for each group. Statistical analyses were performed using ANOVA for multiple group comparison and two-tailed Student's t test for two-group comparison. All tests of significance were two sided, and differences were considered statistically significant at a P value of <0.05.
|
Results
|
|---|
IKK expression is increased in tumor endothelium. Although it is clear that the NF-B pathway plays a critical role in tumor development, most of the focus has been placed on the role of IKKβ. To investigate the potential function of IKK in tumor angiogenesis, we examined IKK expression in tumor samples. Murine LLC tumor tissues were processed for immunofluorescent staining with antibodies against IKK and the vascular marker CD31 (Fig. 1A
). Surrounding normal tissues were used as controls. We observed a clear increase of IKK levels in tumor tissues compared with normal tissues. Interestingly, double staining with CD31 antibody indicates that IKK is highly expressed in the tumor vasculature (Fig. 1A). Similarly, we observed a significant increase of IKK in human lung cancer biopsies compared with adjacent normal lung tissues (Fig. 1B). These results suggest a potential role of IKK in tumor angiogenesis.
IKK induces angiogenesis in vitro. Angiogenesis is a multistep process that includes endothelial cell migration, proliferation, and tubule formation. Therefore, we examined the function of IKK in each of these areas. We used adenoviral vectors for efficient gene delivery in endothelial cells, as described previously (16). Micro and large endothelial cells (HDVECs or HUVECs) were infected with adenoviral vectors directing the expression of IKK, IKB, IKKβ, or IKK plus IKB, for 36 hours. A viral vector expressing GFP was used as a vector control, as well as for evaluation of transgene transduction efficiency. We achieved >85% transduction efficiency, determined by counting GFP-positive cells over total cells (data not shown). Transgene expression was also confirmed by Western blot analysis (Fig. 2E
).
Next, we analyzed the effects of IKK on endothelial cell migration. We found that overexpression of IKK significantly increased cell migration compared with control treated cells (Fig. 2A). Interestingly, this induction of cell migration could be completely blocked with the coexpression of IB, an inhibitor of NF-B, suggesting that IKK-mediated endothelial motility is dependent on activation of NF-B signaling. In contrast, IKKβ has no significant effect on endothelial cell migration (Fig. 2A). Conversely, we knocked down IKK in endothelial cells using shRNA. We achieved >85% IKK reduction in these cells compared with untreated or scrambled controls (data not shown). Knockdown of IKK significantly impaired cell motility compared with controls (Fig. 2B). Consistent with the cell migration results, expression of IKK, but not IKKβ, significantly increased vascular tubule formation in a three-dimensional Matrigel assay compared with control cells, and blocking NF-B activity by overexpressing IB completely inhibited IKK-induced vascular network formation (Fig. 2C and D). Furthermore, there was less vascular network formation in the IB group than the vector control (Fig. 2D), which supports an intrinsic role for NF-B in angiogenesis. However, we did not find any difference in endothelial cell proliferation between the IKK group and vector controls by measuring the amount of BrdUrd incorporation in cells (data not shown). Collectively, these data suggest that IKK mediates angiogenesis via an effect on endothelial cell motility through the NF-B canonical pathway.
IKK promotes tumor angiogenesis and tumor growth in vivo. To investigate the role of IKK in tumor angiogenesis in vivo, we used a tumor and endothelial cell cotransplantation assay, following a published protocol (14), which allows us to genetically manipulate vascular endothelial cells. LLC-tumor cells and viral vector-infected endothelial cells expressing IKK or β-gal were mixed with Matrigel and implanted into immune deficient Rag-1 mice. As an additional control, LLC cells alone in Matrigel were used. As expected, expression of IKK in endothelial cells led to a significant increase in tumor growth compared with the controls of tumor cells alone or tumor cells mixed with endothelial cells expressing β-gal (Fig. 3
).
Consistent with the observed increase in tumor growth, histologic examination of tumor tissues showed significantly more blood vessels in tumors mixed with IKK-expressing endothelial cells compared with the vector control group and tumor cells alone (Fig. 4A and B
). Based on the data indicating that IKK promotes endothelial cell migration and vascular network formation, we postulated that expression of IKK in endothelial cells might increase tumor vascular formation through direct incorporation into tumor vasculature. To test the hypothesis, we used a human-specific CD31 antibody to detect exogenous human endothelial cells and a murine-specific CD31 antibody to detect the host-derived vasculature. We observed incorporation of exogenous human endothelial cells into tumor vasculature in both groups (Fig. 4C). Importantly, there were significantly more human endothelial cells incorporated into the tumor vasculature in the IKK group than in the β-gal–expressing control group (Fig. 4C and D), which is in agreement with our in vitro data that IKK promotes endothelial motility and vascular tubule formation.
View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 4. Expression of IKK in endothelial cells promotes tumor vascular formation through direct incorporation into tumor vasculature. Tumors from each group were harvested 8 d after implantation. Tumor sections were immunostained with antibody against pan CD31, which recognizes both human and murine endothelium (A). The number of CD31-positive blood vessels were counted in 10 randomly selected x200 fields, (B). *, P < 0.05. Tumor sections were double stained with antibodies against human-specific CD31 (green) and murine-specific CD31 (red; C). The percentage of human CD31–positive blood vessels over total blood vessels was graphed (D).
|
|
Further histologic analysis of tumor tissues showed that there were fewer apoptotic cells present among the tumor cells mixed with IKK-expressing endothelial cells than in both control groups (Fig. 5A and D
). Similarly, there was an increase in cell proliferation of the tumor cells mixed with IKK-expressing endothelial cells compared with either control (Fig. 5B and E). Consistent with these findings, we observed a decrease of hypoxic regions in tumor cells mixed with IKK-expressing endothelial cells compared with controls (Fig. 5C). Collectively, these findings indicate that IKK promotes tumor vascular formation, resulting in better nutrient and oxygen supplies for tumor growth and progression.
View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
|
Figure 5. IKK expression in the endothelium decreases tumor hypoxia and apoptosis, increases cell proliferation. Tumor tissue sections from each group were subjected to TUNEL assay. DAPI staining was used to illuminate nuclei (A). TUNEL-positive apoptotic cells (pink) were quantified in 10 randomly selected high power fields under microscopy (D); *, P < 0.05. Tumor sections were probed with antibody against PCNA and counterstained with hematoxylin (B). PCNA-positive proliferating cells were counted in 10 randomly selected high power fields under microscopy (E); *, P < 0.05. Tumor sections were also probed with antibody against hypoxia mediated DNA adducts. Arrows, hypoxic cells (C).
|
|
|
Discussion
|
|---|
Although NF-B has been linked to tumor development and angiogenesis, most studies are focused on IKKβ. In this study, we show that IKK is elevated in tumor endothelium compared with normal tissues. Also, overexpression of IKK in endothelial cells increased cell motility and vascular network formation in vitro, and tumor angiogenesis in vivo. As a result, it reduced hypoxia and apoptosis, increased cell proliferation, as well as promoted tumor growth. In contrast, IKKβ did not affect angiogenic properties in endothelial cells. Interestingly, IKK-mediated angiogenic responses are dependent on NF-B activation. Together, these findings reveal a new function of IKK through the NF-B canonical pathway in tumor angiogenesis.
The IKK complex contains two catalytic subunits, IKK and IKKβ,both of which share a similar structure. IKK and IKKβ differ, however, in their physiologic functions (4, 5). Published data indicate that IKKβ is sufficient to mediate NF-B activation in response to proinflammatory cytokines and microbial products (4, 5). IKK seems to be dispensable for these functions. On the other hand, studies have identified essential functions of IKK in the development of teeth and the epidermis and its derivatives; yet, these functions are mediated through an alternative pathway. independent from NF-B activation (8, 17–19). Importantly, we identify an IKK-specific role in angiogenesis though canonical NF-B signaling in this study. IKK-induced angiogenic functions could be completely attenuated with coexpression of IB, thus indicating that IKK is acting although the canonical, rather than the IKK-specific noncanonical pathway. Most surprisingly, IKK, but not IKKβ, the primary IKK in canonical NF-B signaling, could induce endothelial cell motility and vascular network formation. This finding adds another level of complexity to NF-B signaling and shows an added importance for IKK in this pathway.
NF-B is implicated in tumor angiogenesis (1). Most studies of this process have focused on the regulation of proangiogenic factors, including VEGF, interleukin (IL)-1β, IL-6, and IL-8. A recent report shows that overexpression of a kinase-dead IKK in tumor cells strongly inhibits both the constitutive NF-B–dependent promoter and endogenous gene activation. Targeted array-based gene expression analysis reveals that many of the genes down-regulated upon inhibition of this pathway are involved in tumor angiogenesis (20). Consistent with these published data, molecular profiling in our study showed an elevation of VEGF, IL6, and basic fibroblast growth factor in IKK-expressing endothelial cells compared with control cells (data not shown). It suggests that IKK can also promote vascular formation through induction of angiogenic genes, in addition to increased endothelial cell motility observed in this study. Although NF-B has yet to be directly linked to angiogenesis, it should be noted that IKK-null mice die 30 minutes after birth and show evidence of cardiovascular and potential angiogenic defects (17). In addition, angiogenic factors such as VEGF and angiopoietin 1 have been shown to activate the Akt-IKK-NF-B pathway (21–23). These data support our finding of a role for IKK in vascular motility and angiogenesis.
According to a recent review, there have been over 750 NF-B inhibitors developed (24). However, none of the developed inhibitors are currently being used clinically. One reason for this may be the potentially severe side effects of inhibiting the NF-B pathway in its entirety. Based on our data, drugs targeting IKK, rather than IKKβ or the entire NF-B signaling pathway, may prove beneficial in a potential clinical setting.
In summary, this study reveals a new role of IKK in angiogenesis that is dependent on NF-B activity. A better understanding of the molecular mechanism of tumor angiogenesis offers the promise for development of novel therapeutic strategies for cancer treatment.
|
Disclosure of Potential Conflicts of Interest
|
|---|
No potential conflicts of interest were disclosed.
|
Acknowledgments
|
|---|
Grant support: NIH CA108856, NS45888, and AR053718 (P.C. Lin) and a training grant T32CA009592 (L.M. DeBusk).
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Kimberly Boelte at Vanderbilt University Medical Center for editing the manuscript.
Received 5/15/08.
Revised 9/16/08.
Accepted 9/26/08.
|
References
|
|---|
- Karin M. Nuclear factor-B in cancer development and progression. Nature 2006;441:431–6.[CrossRef][Medline]
- Kim HJ, Hawke N, Baldwin AS. NF-B and IKK as therapeutic targets in cancer. Cell Death Differ 2006;13:738–47.[CrossRef][Medline]
- Basseres DS, Baldwin AS. Nuclear factor-B and inhibitor of B kinase pathways in oncogenic initiation and progression. Oncogene 2006;25:6817–30.[CrossRef][Medline]
- Ghosh S, Karin M. Missing pieces in the NF-B puzzle. Cell 2002;109 Suppl:S81–96.[CrossRef][Medline]
- Baldwin AS, Jr. The NF-B and IB proteins: new discoveries and insights. Annu Rev Immunol 1996;14:649–83.[CrossRef][Medline]
- Takaesu G, Surabhi RM, Park KJ, et al. TAK1 is critical for IB kinase-mediated activation of the NF-B pathway. J Mol Biol 2003;326:105–15.[CrossRef][Medline]
- Solt LA, Madge LA, Orange JS, et al. Interleukin-1-induced NF-B activation is NEMO-dependent but does not require IKKβ. J Biol Chem 2007;282:8724–33.[Abstract/Free Full Text]
- Senftleben U, Cao Y, Xiao G, et al. Activation by IKK of a second, evolutionary conserved, NF-B signaling pathway. Science 2001;293:1495–9.[Abstract/Free Full Text]
- Anest V, Hanson JL, Cogswell PC, et al. A nucleosomal function for IB kinase- in NF-B-dependent gene expression. Nature 2003;423:659–63.[CrossRef][Medline]
- Yamamoto Y, Verma UN, Prajapati S, et al. Histone H3 phosphorylation by IKK- is critical for cytokine-induced gene expression. Nature 2003;423:655–9.[CrossRef][Medline]
- Jobin C, Panja A, Hellerbrand C, et al. Inhibition of proinflammatory molecule production by adenovirus- mediated expression of a nuclear factor B super-repressor in human intestinal epithelial cells. J Immunol 1998;160:410–8.[Abstract/Free Full Text]
- Lin P, Buxton JA, Acheson A, et al. Antiangiogenic gene therapy targeting the endothelium-specific receptor tyrosine kinase Tie2. Proc Natl Acad Sci U S A 1998;95:8829–34.[Abstract/Free Full Text]
- Kamiyama M, Pozzi A, Yang L, et al. EP2, a receptor for PGE2, regulates tumor angiogenesis through direct effects on endothelial cell motility and survival. Oncogene 2006;25:7019–28.[CrossRef][Medline]
- Brantley-Sieders DM, Fang WB, Hicks DJ, et al. Impaired tumor microenvironment in EphA2-deficient mice inhibits tumor angiogenesis and metastatic progression. FASEB J 2005;19:1884–6.[Abstract/Free Full Text]
- Yang L, Debusk LM, Fukuda K, et al. Expansion of myeloid immune suppressor Gr+CD11b+ cells in tumor-bearing host directly promotes tumor angiogenesis. Cancer Cell 2004;6:409–21.[CrossRef][Medline]
- Kobayashi H, DeBusk LM, Babichev YO, et al. Hepatocyte growth factor mediates angiopoietin-induced smooth muscle cell recruitment. Blood 2006;108:1260–6.[Abstract/Free Full Text]
- Hu Y, Baud V, Delhase M, et al. Abnormal morphogenesis but intact IKK activation in mice lacking the IKK subunit of IB kinase. Science 1999;284:316–20.[Abstract/Free Full Text]
- Hu Y, Baud V, Oga T, et al. IKK controls formation of the epidermis independently of NF-B. Nature 2001;410:710–4.[CrossRef][Medline]
- Ohazama A, Hu Y, Schmidt-Ullrich R, et al. A dual role for Ikk in tooth development. Dev Cell 2004;6:219–27.[CrossRef][Medline]
- Agarwal A, Das K, Lerner N, et al. The AKT/I B kinase pathway promotes angiogenic/metastatic gene expression in colorectal cancer by activating nuclear factor- B and β-catenin. Oncogene 2005;24:1021–31.[CrossRef][Medline]
- Marumo T, Schini-Kerth VB, Busse R. Vascular endothelial growth factor activates nuclear factor-B and induces monocyte chemoattractant protein-1 in bovine retinal endothelial cells. Diabetes 1999;48:1131–7.[Abstract]
- Kim I, Moon SO, Kim SH, et al. Vascular endothelial growth factor expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and E-selectin through nuclear factor- B activation in endothelial cells. J Biol Chem 2001;276:7614–20.[Abstract/Free Full Text]
- DeBusk LM, Hallahan DE, Lin PC. Akt is a major angiogenic mediator downstream of the Ang1/Tie2 signaling pathway. Exp Cell Res 2004;298:167–77.[CrossRef][Medline]
- Gilmore TD, Herscovitch M. Inhibitors of NF-B signaling: 785 and counting. Oncogene 2006;25:6887–99.[CrossRef][Medline]
This article has been cited by other articles:
|
|
|
|
 
J. M. Warfel and F. D'Agnillo
Anthrax Lethal Toxin Enhances I{kappa}B Kinase Activation and Differentially Regulates Pro-inflammatory Genes in Human Endothelium
J. Biol. Chem.,
September 18, 2009;
284(38):
25761 - 25771.
[Abstract]
[Full Text]
[PDF]
|
|
|
Top
Abstract
Introduction
