| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology, Pathobiology, and Genetics |
1 Arizona Cancer Center and 2 Center for Toxicology, University of Arizona, Tuczon, Arizona
Requests for reprints: G. Tim Bowden, Arizona Cancer Center, University of Arizona, 1515 N. Campbell, Tucson, AZ 85724. Phone: 520-626-6006; Fax: 520-626-4979; E-mail: tbowden{at}azcc.arizona.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The antiapoptotic molecule Bcl-XL is crucial for the survival of many types of cells and has been implicated in differentiation and development (13, 14). For example, knockout of Bcl-XL is lethal in mice, resulting from extensive death of hematopoietic cells and atrophy of the brain (15). On the other hand, substantial induction of this molecule renders activated T cells resistant to apoptosis upon CD28 stimulation (16). Its importance can be further illustrated by its involvement in cancer development. Overexpression of Bcl-XL is observed in several types of cancers, i.e., colorectal and breast cancer (14, 17). The importance of Bcl-XL in skin carcinogenesis has been well defined in both cultured cells and animal models (18, 19). Furthermore, Bcl-XL confers drug resistance in multiple cancers (20, 21) and inversely correlates with prognosis in some cancers (22). Therefore, a thorough understanding of the regulation of Bcl-XL will pave the way for novel strategies of cancer chemotherapy and chemoprevention.
Bcl-XL primarily localizes to the mitochondrial membrane. Through its BH1-3 domains, Bcl-XL is able to bind and sequester proapoptotic molecules possessing the BH-3 domain (23). The primary targets for Bcl-XL are Bax and Bak, which migrate to and oligomerize on the outer mitochondrial membrane and thus change the permeability of the mitochondria, leading to the release of small molecules, including cytochrome c. The release of cytochrome c triggers the assembly of apoptosomes and, thus, activation of caspase cascade (13, 14, 17). It has been postulated that Bcl-XL blocks the oligomerization of Bax and Bak and, thus, the release cytochrome c (23).
The expression of Bcl-XL is tightly regulated at transcriptional (24, 25), alternatively splicing (24), and translational levels (16). Recently, our laboratory has shown that its mRNA stability can also be regulated in human keratinocytes upon irradiation with 250 kJ/m2 UVA. Furthermore, this stabilization is dependent upon the 3'-UTR of the Bcl-XL mRNA (26). However, the mechanism for the mRNA stabilization of the Bcl-XL mRNA is unclear.
The regulation of mRNA stability enables cells to rapidly adjust to environmental changes (27, 28). Indeed, mRNAs of some regulatory molecules, such as c-myc, cyclins, p27, cyclooxygenase-2 (Cox-2), and interleukin 2 (IL-2), are normally short-lived, and their stability is subject to change upon external stimulation (29). In mammalian cells, the rate-limiting step of mRNA degradation is polyadenylate [poly(A)] deadenylation, which is mediated by poly(A) RNase (PARN; ref. 28). Shortening of poly(A) tail to
30 to 60 nucleotides in mammalian cells is required for mRNA degradation (30). After deadenylation, hydrolysis of 5' m7G cap takes place, allowing degradation of decapped mRNA by 5'-3' exoribonuclease, Xrn1 (31–33). However, it has been argued that the primary degradation pathway in mammalian cells is mediated by exosomes, complexes composed of at least ten 3'-5' exonucleases (28, 31, 32).
It has been shown that stability of many mRNAs is dependent upon their 3'-UTRs, including those of cyclins, Cox-2, IL-2, renin, c-myc, IL-6, granulocyte macrophage colony–stimulating factor, ferritin, and glucose transport 1 (27–29, 34). Prominently, a cis-element, AU-rich element (ARE), has been well defined and shown to be critical for the stability of these mRNAs. It was estimated that 5% to 8% of all mRNAs contain variable numbers of AREs (27, 34).
Despite the fact that ARE was identified >15 years ago, the mechanism of how it functions was not unraveled until recently. Several studies related to known ARE-binding proteins indicated that some ARE-binding proteins physically interact and thus recruit RNA decay machinery to accelerate RNA degradation. For example, K homology splicing regulatory protein (KSRP) has been known as a destabilizing factor. In a recent study, Chou et al. made a fusion protein between KSRP and MS2, a bacteriophage coat protein. This fusion protein led to a dramatic decrease in the β-globin message that contained six MS2 binding sites. Furthermore, they found that PARN and RRP4 exosome components could be coimmunoprecipitated with KSRP (35). These data suggested that KSRP accelerates mRNA degradation by recruiting the PARN and exosomes. Similarly, other studies showed that two other destabilizing ARE-binding proteins, Tristetraprolin and ARE/poly(U)-binding/degradation factor 1 (AUF1), could also associate with exosomes (31).
Meanwhile, a number of studies also showed a stabilizing function of AREs (36–39). For example, HuR can stabilize a number of messages, such as β-casein, SLC11A1, p21, cyclins A and B1, Cox-2, and renin, through the ARE element (40). One ubiquitous protein, nucleolin, has also been reported to stabilize several messages, such as Bcl-2, IL-2, and Gadd45 (37, 38, 41).
To understand how the Bcl-XL mRNA was stabilized upon UVA irradiation in human keratinocytes (HaCaT cells), we identified nucleolin as one of the proteins binding to the 3'-UTR of the mRNA. In this report, we provide evidence that nucleolin can bind to the ARE element on the 3'-UTR of the Bcl-XL mRNA and stabilize the message in vitro and in vivo. Moreover, nucleolin stabilization of the Bcl-XL mRNA is dependent on the poly(A) tail and poly(A) binding protein (PABP). Finally, we offer a model to explain how nucleolin stabilizes the Bcl-XL mRNA.
| Materials and Methods |
|---|
|
|
|---|
Mutagenesis. The three AREs on both the constructs pBS-1287UTR(WT) and TOPO-Full(WT) were mutated with Quickchange kit (Stratagene). The primer sets to mutate the AREs were 5'-cttgcagctagttttctagaacccatcacacttctgtgagaccc-3' and 5'-gggtctcacagaagtgtgatgggttctaaaactagctgcaag-3' (ARE1), 5'-ccccctaagagccacccaggggccactttttgact-3' and 5'-agtcaaaagtggcccctgggtggctcttaggggg (ARE2), and 5'-ttttgttaagcgtgtctgtacccatgtgtgaggagctgctgg-3' and 5'-cagcagctcctcacacatgggtacagacacgcttaacaaaa-3' (ARE3).
RNA affinity chromatography. UVA and SB202190 treatment of HaCaT cells (immortalized human keratinocytes) was described previously (26). These samples were subject to the RNA affinity chromatography as described by Cok et al. (45). Briefly, the treated cells were washed twice with cold PBS and scraped off the plate with the EMSA binding buffer [10 mmol/L HEPES (pH 7.6), 5 mmol/L MgCl2, 40 mmol/L KCl, 1 mmol/L DTT, 5% glycerol, 5 mg/mL heparin]. The cells were sonicated and centrifuged. The supernatant was used for the subsequent RNA binding assay. To transcribe Bcl-XL 3'-UTR in vitro, the construct pBS-1287UTR(WT) was completely digested by XhoI and phenol extracted. This linearized DNA template was transcribed and biotinylated with MEGAscript T7 kit (Ambion) according to the manufacturer's instructions. Subsequently, 500 µg cell lysate were incubated with 20 µg of biotinated RNA on ice for 1 h. The mixture was further incubated with 0.2 mL Streptavidin Sepharose beads (Amersham) overnight at 4°C with rotation. The beads were loaded on a column and washed with 20 mL of the binding buffer. The beads were boiled with SDS-PAGE loading buffer to release captured proteins, which were resolved on a 10% SDS-PAGE gel. The proteins were silver-stained with a mass spec compatible kit (Invitrogen) and those differentially captured bands were excised for mass spec analysis.
Tandem mass spectrometry coupled to liquid chromatography. Excised protein bands after SDS-PAGE were digested in trypsin (10 µg/mL) at 37°C overnight. Tandem mass spectrometry coupled to liquid chromatography (LC-MS/MS) analyses of in-gel trypsin digestion was performed as previously described (46). Protein bands were analyzed using a quadrupole ion trap ThermoFinnigan LCQ DECA XP PLUS equipped with a Michrom Paradigm MS4 HPLC and a nanoelectrospray source. Peptides were eluted from a 15-cm pulled tip capillary column (100 µm I.D. x 360 µm O.D.; 3–5 µm tip opening) packed with 7 cm Vydac C18 material (5 µm, 300 Å pore size), using a gradient of 0 to 65% solvent B (98% methanol:2% water:0.5% formic acid:0.01% triflouroacetic acid) over a 60-min period at a flow rate of 350 nL/min. The LCQ DECA XP PLUS electrospray positive mode spray voltage was set at 1.6 kV, and the capillary temperature was at 200°C. Dependent data scanning was performed by the Xcalibur v 1.3 software (47) with a default charge of 2, an isolation width of 1.5 amu, an activation amplitude of 35%, an activation time of 30 ms, and a minimal signal of 10,000 ion counts. Global dependent data settings were as follows: reject mass width of 1.5 amu, dynamic exclusion enabled, exclusion mass width of 1.5 amu, repeat count of 1, repeat duration of 1 min, and exclusion duration of 5 min. Scan event series included one full scan with mass range of 350 to 2,000 Da, followed by three dependent MS/MS scan of the most intense ion. Tandem MS spectra of peptides were analyzed with Turbo SEQUEST v 3.1, a program that allows the correlation of experimental tandem MS data with theoretical spectra generated from known protein sequences (48). The peak list (data files) for the search was generated by Xcalibur 1.3. Parent peptide mass error tolerance was set at 1.5 amu, and fragment ion mass tolerance was set at 0.5 amu during the search. The criteria that were used for a preliminary positive peptide identification are the same as previously described, namely peptide precursor ions with a +1 charge having an Xcorr of >1.8, +2 Xcorr of > 2.5, and +3 Xcorr of >3.5. A dCn score of >0.08 and a fragment ion ratio of experimental/theoretical of >50% were also used as filtering criteria for reliable matched peptide identification (49). All matched peptides were confirmed by visual examination of the spectra. All spectra were searched against the latest version of the nonredundant protein database downloaded on July 14, 2005 from National Center for Biotechnology Information (NCBI). At the time of the search, the nonredundant protein database from NCBI contained 2,662,317 entries.
UV-crosslinking assay. The Bcl-XL 3'-UTR was synthesized and 32P-labeled from XhoI linearized pBS-1287(WT) plasmid with the Riboprobe In vitro Transcription System (Promega). After removal of unincorporated nucleotides by P-6 minicolumn (Bio-Rad), 5 million counts per million were incubated with 0.1 µg of MBP-Nucleolin on ice for 30 min, followed by UV cross-linking by Genelinker (Bio-Rad). RNase A1 (2.5 µg; Sigma) was added to the reaction and incubated at 37°C for 1 h. The reaction was resolved on a SDS-PAGE gel and autoradiographed.
RNA immunoprecipitation and RT-PCR. RNA immunoprecipitation was performed as previously described (41). Briefly, HaCaT cells were lysed with radioimmunoprecipitation assay (RIPA) buffer with protease inhibitors. Antibodies (2 µg) were incubated with 500 µg lysates for 4 h at 4°C. Protein A/G beads (Santa Cruz Biotech) were added and incubated overnight at 4°C. The beads were washed five times with RIPA buffer, and RNA was extracted with Trizol reagent (Invitrogen). The extracted RNA was reverse-transcribed with the Protoscript First Strand cDNA synthesis kit (New England Biolabs) and followed by PCR to generate a Bcl-XL specific fragment with the primer set: cattgccaccaggagaaccactac (forward) and catctttatcccaagcagcct (reverse).
Cell transfection. The transfection of pEGFP-nucleolin (generous gift from Dr. Kastan) was performed with LipofectAMINE 2000 (Invitrogen) according to the manufacturer's instruction. The transfection of the nucleolin and control small interfering RNA (siRNA; Qiagen) was performed with HiPerFect (Qiagen) based on the manufacturer's protocol. The siRNA effects were monitored 60 h after transfection by Western blot analysis.
RT-PCR and real-time PCR. The RNA was extracted with Trizol reagent (Invitrogen) and reverse-transcribed with high-capacity cDNA reverse transcription kit (Applied Biosystems, Inc.) according to the manufacturers' instructions. The real-time PCR was performed with Taqman probes for human Bcl-XL and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) on the ABI PRISM 7700 sequence detection system (Applied Biosystems). The mRNA level of Bcl-XL was normalized to GAPDH in each sample according to the User Bulletin 2 of ABI PRISM 7700 sequence detection system.
Western blot analysis and immunoprecipitation. The Western blot analysis and immunoprecipitation were described previously (26). The monoclonal antibodies against nucleolin (MS-3, D6) and PABP (10E10), as well as protein A/G beads, were purchased from Santa Cruz Biotech.
In vitro RNA degradation assays. The experiments were performed as described by Chen et al. (41). Briefly, the full-length Bcl-XL mRNA (
3500nt) was transcribed in vitro from the XbaI-linearized TOPO-Full(WT) with mMessage mMachine T7 kit (Ambion). Next, 10 million counts per minute of the 32P-labeled Bcl-XL mRNA (5'-capped and 3'-polyadenylated) were incubated at 37°C with 20 µg of S100 fraction of HaCaT cells in 25 µL of EMSA buffer in the presence or absence of 5 µg MBP-nucleolin. Samples were taken at the indicated times and resolved on SDS-PAGE gel, followed by autoradiography.
| Results |
|---|
|
|
|---|
|
|
|
Nucleolin binds to AREs of the 3'-UTR. Next, we sought to investigate what cis-element on the 3'-UTR nucleolin bound. It has been reported that nucleolin binds to ARE of several other mRNA molecules, including Bcl-2 (37, 38). We found that there are three AUUUA elements on the 3'-UTR of Bcl-XL. To test if nucleolin also binds to these ARE elements, we mutated all of the three AREs from AUUUA to ACCCA and used the mutated version for the protection assay. We found that nucleolin failed to protect any region when all of the three AREs were mutated (Fig. 3B, lane 3). Therefore, the result clearly showed that the recombinant nucleolin could bind to the AREs of the Bcl-XL 3'-UTR in vitro. Moreover, nucleolin could still protect RNA with single or double ARE mutations (data not shown), suggesting that nucleolin binding to single ARE could protect the RNA from degradation.
Nucleolin binds to the Bcl-XL 3'-UTR in vivo. The above result was achieved in vitro with the recombinant protein. We next asked the question if the endogenous nucleolin could also bind the Bcl-XL 3'-UTR in intact cells. To answer this question, we used the RNA immunoprecipitation to pull down nucleolin together with its potential mRNA targets. This technique has been successfully used to examine in vivo RNA-protein interactions (53, 54). After RT-PCR amplification with the Bcl-XL specific primers, we found that the sample immunoprecipitated with the antinucleolin antibody generated a band of the expected size (
500 bp), whereas the sample immunoprecipitated with the mouse IgG failed to yield the specific band (Fig. 3C). This result showed that Bcl-XL mRNA was bound by endogenous nucleolin in intact cells.
Nucleolin can stabilize Bcl-XL mRNA RNA both in vitro and in vivo. We wanted to understand the biological significance of the nucleolin binding to the 3'-UTR of Bcl-XL message. Nucleolin has been shown to stabilize mRNAs of several molecules, including Bcl-2 (37, 38, 41). Therefore, it was possible that nucleolin could also stabilize the Bcl-XL mRNA. To test this hypothesis, we transcribed the full-length Bcl-XL (3500nt, including 5'-UTR, coding region, and 3'-UTR) in vitro. This m7G capped and polyadenylated RNA was incubated with S100 cellular fraction in the presence or absence of recombinant nucleolin. As shown in Fig. 4A
, the half-life of the Bcl-XL mRNA increased from
2 h (without nucleolin) to
4 h (with nucleolin). Therefore, nucleolin was able to stabilize the Bcl-XL mRNA in vitro (Fig. 4A).
|
We transfected HeLa cells with pEGFP-nucleolin or the empty control vector pEGFPC1. There was
40% to 50% of the cells expressing green fluorescence 20 h after transfection (data not shown). We found that overexpression of Bcl-XL does extend the half-life of the Bcl-XL mRNA to longer than 6 h (Fig. 4B).
To support the above result, we also used siRNA to knockdown nucleolin expression. We found that there was a 60% reduction of nucleolin protein after 60 h of the siRNA treatment compared with the negative control (data not shown). Therefore, we compared the half-lives of the Bcl-XL mRNA in these cells. As shown in Fig. 4C, there was a reduction of the Bcl-XL mRNA in the nucleolin siRNA-treated cells.
In Fig. 3C, we showed that nucleolin binds to the 3'-UTR of the Bcl-XL mRNA. We reasoned that this binding is important for the nucleolin regulation of the Bcl-XL mRNA. To test this idea, we cotransfected the cells with nucleolin and luciferase reporter fused to the Bcl-XL 3'-UTR. We found that cotransfection with nucleolin increased the luciferase activity to
9-fold compared with the empty vector (pEGFPC1) control (Fig. 4D), indicating that the 3'-UTR may confer nucleolin stabilization of the Bcl-XL mRNA.
Poly(A) tail is required for the nucleolin stabilization of Bcl-XL. It has been an intriguing goal to understand how AREs and RNA-binding proteins modulate stability of their targets. There are two possibilities for nucleolin stabilization of Bcl-XL mRNA. One is that nucleolin binds to a certain region and protects that region from degradation. Alternatively, nucleolin may help protect the mRNA poly(A) tail from deadenylation, which is the first step for mRNA degradation. To distinguish the two possibilities, we devised a simple experiment. We synthesized the mRNA with or without the poly(A) tail and compared the nucleolin stabilization effects on these two RNA species. We reasoned that for the first possibility, nucleolin would have the same effect on the RNA stability using both mRNA species. However, the half-lives of the two mRNA species were different, indicating that nucleolin failed to stabilize the mRNA without polyadenylation (Fig. 5A ). These results supported the second possibility that nucleolin might help protect the poly(A) tail from deadenylation.
|
Nucleolin has a physical interaction with PABP. As the poly(A) tail is important for the nucleolin stabilization of Bcl-XL mRNA and the poly(A) tail is primarily bound by the PABP, we reasoned that this stabilization might be achieved through a physical interaction between nucleolin and PABP. To test this hypothesis, we used the purified recombinant proteins to examine their interactions. We reasoned that if they interacted with each other, pulling down either one of them could capture the other by affinity chromatography. Therefore, we used amylase resin to pull down MBP-tagged nucleolin and Ni-NTA agarose for His6-tagged PABP. As shown in Fig. 5B, nucleolin was detected in amylase resin (lanes 2 and 3) as expected. In Ni-NTA agarose, however, nucleolin was detected only when incubated with His6-PABP (Fig. 5C, lane 3). In comparison, nucleolin did not bind to the Ni-NTA beads (Fig. 5C, lane 2). Conversely, PABP did bind to Ni-NTA agarose (Fig. 5D, lanes 1 and 3) as expected, but it could only be detected in the amylose resin when incubated with MBP-nucleolin (Fig. 5E, lane 3). These results indicated that PABP and nucleolin interact with each other in vitro, and this interaction is not RNA dependent.
Nucleolin has four RNA-binding domains and nine Arg-Gly-Gly (RGG) motifs (43) at its COOH terminus. It has been shown that these RGG motifs are involved in interacting with both ribosomal proteins (55) and DNA G-quadraplex (43). Using the recombinant nucleolin with different domains, we found that the recombinant protein Nuc-RGG9 alone was able to pull down PABP (Fig. 5F, lane 2) even in the absence of any RNA-binding domains, whereas the truncated region Nuc-RGG4 failed to do so (Fig. 5F, lane 1). This result is similar to the previous report that the binding of Nuc-RGG9 to DNA G-quadraplex was abolished when Nuc-RGG9 was truncated to Nuc-RGG4 (43). Therefore, our data suggested that the full-length RGG motifs are required for interacting with PABP and the RNA binding domains may not be necessary for this interaction. Because the MBP fusion proteins were used in the experiments, we examined if MBP alone could interact with PABP. As shown in Fig. 5F (lane 3), there was no PABP detected. This result ruled out the possibility that MBP interacts with PABP.
To test if nucleolin interacts with PABP in intact cells, we used reciprocal immunoprecipitation to pellet both proteins. As expected, nucleolin was detected in the sample precipitated with the anti-PABP antibody (Fig. 6A ), whereas the control IgG did not pellet nucleolin. Similarly, PABP was present in the antinucleolin antibody–precipitated sample (Fig. 6B). Therefore, these data strongly showed that PABP interacts with nucleolin.
|
| Discussion |
|---|
|
|
|---|
To better understand the molecular mechanism whereby the Bcl-XL mRNA is stabilized upon UVA irradiation, we used RNA affinity chromatography to capture proteins that were differentially bound to the Bcl-XL 3'-UTR. This technique has been successfully used in identifying RNA-binding proteins, i.e., Renin (57), and nucleoplasmin (51). In our experiment, we found that at least 10 protein bands were differentially bound to the RNA column upon UVA irradiation.
One of the bands was identified as nucleolin (Fig. 1). Nucleolin possesses four RNA-binding domains and reportedly stabilizes multiple RNA molecules (38, 41, 51). Interestingly, nucleolin stabilizes the Bcl-2 mRNA in HL-60 cells (37). Furthermore, we found that the binding of nucleolin to the beads increased in UVA-irradiated cells, indicating that nucleolin may play a role in the UVA response in human keratinocytes (Fig. 1, lane 2 and Fig. 3A, lane 3, top). Therefore, we reasoned that nucleolin might bind to and stabilize the Bcl-XL mRNA in UVA-irradiated human keratinocytes.
Nucleolin is a ubiquitously expressed protein and involved in important biological processes, such as cell cycle regulation and ribosomal biogenesis (58). Nucleolin has been implicated in apoptosis through various mechanisms. For example, overexpression of nucleolin increases the expression of p53 protein and thus promotes apoptosis in HCT116 or U2-OS cells by inhibiting MDM2-mediated ubiquitination (59). In contrast, nucleolin is antiapoptotic in other studies (37, 38, 51). Our data are consistent with previous findings that nucleolin regulates gene expression by stabilizing mRNAs (37, 38, 41). For example, nucleolin, together with another protein YB-1, stabilizes IL-2 mRNA in a JNK kinase–dependent manner (41). These two proteins recognize a cis-element called JNK response element at the 5'-UTR of IL-2 and stabilize IL-2 mRNA both in vitro and in vivo.
How nucleolin stabilizes the Bcl-XL mRNA remains unclear. However, in this report, we provide evidence that nucleolin stabilization of Bcl-XL requires the poly(A) tail and that there is a physical interaction between nucleolin and PABP. Our data suggest that nucleolin-PABP interaction may also be direct, because the recombinant proteins interact with each other in the absence of any RNA (Fig. 5). Furthermore, our data suggest that all RGG motifs of nucleolin may be required for this interaction (Fig. 5F).
The biological significance of the PABP-nucleolin interaction is not clear. A similar finding was reported. HuR, a well-studied RNA-stabilizing protein, was found to interact with PABP. Nagaoka et al. reported that HuR-PABP interaction is essential to the β-casein mRNA stability (40). Likewise, we postulate that interactions between PABP and RNA-stabilizing proteins, i.e., nucleolin, may block the action of PARN and therefore slow down deadenylation process. Furthermore, PABP has been shown to interact with proteins binding to the 5'-UTR, i.e., eIF, forming a RNA loop structure that stabilizes mRNA and facilitates translation. Therefore, we propose a similar model contributing to UVA-mediated resistance to apoptosis in human keratinocytes. In this model, UVA irradiation increases the binding capacity of nucleolin to the AREs on the 3'-UTR of Bcl-XL mRNA in a p38 MAPK-dependent manner. Subsequently, nucleolin binds to PABP in proximity through the RGG motifs, and this interaction helps stabilize the mRNA loop structure by excluding access of PARN and exosomes from digesting the poly(A) tail. Consequently, the Bcl-XL mRNA is stabilized and its expression increased.
This model does not exclude the possibility that nucleolin may also displace other destabilizing factors from the 3'-UTR. RNA-binding proteins may compete with same cis-elements. For example, HuR binding to the iNOS mRNA is mutually exclusive with KSRP binding (36). Similarly, HuR has been considered to compete with AUF1 (45). Finally, we have considered the possibility that p38-mediated phosphorylation of nucleolin prevents the recruitment of other destabilizing proteins, i.e., Tristetraprolin and KSRP, to mRNAs (35).
In this study, we provide evidence showing that nucleolin binds to the ARE of the 3'-UTR of the Bcl-XL mRNA and stabilizes the message both in vitro and in vivo. Because of the importance Bcl-XL in skin carcinogenesis, a better understanding of its regulation can be helpful for devising novel strategies for treatment and prevention of skin cancers.
| Acknowledgments |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
We thank Drs. Kiledjian, Maizels, and Kastan for providing reagents and Anne Cione for her administrative assistance.
Received 5/23/07. Revised 10/ 1/07. Accepted 12/19/07.
| References |
|---|
|
|
|---|
mRNA. Nucleic Acids Res 2006;34:485–95.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |