Cancer Research Annual Meeting 2010  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

Cancer Research 68, 1916, March 15, 2008. doi: 10.1158/0008-5472.CAN-07-3195
© 2008 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, K.-W.
Right arrow Articles by Bang, Y.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, K.-W.
Right arrow Articles by Bang, Y.-J.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Enzastaurin, a Protein Kinase Cβ Inhibitor, Suppresses Signaling through the Ribosomal S6 Kinase and Bad Pathways and Induces Apoptosis in Human Gastric Cancer Cells

Keun-Wook Lee1,2,6, Sang Gyun Kim2, Hwang-Phill Kim2, Euna Kwon5, Jiran You5, Hyung-Jun Choi5, Jung-Hyun Park2, Byeong-Cheol Kang5, Seock-Ah Im1,2,4, Tae-You Kim1,2,4, Woo Ho Kim3 and Yung-Jue Bang1,2,4

1 Department of Internal Medicine, 2 Cancer Research Institute, and 3 Department of Pathology, Seoul National University College of Medicine; 4 Department of Internal Medicine and 5 Clinical Research Institute, Seoul National University Hospital, Seoul, Korea; and 6 Department of Internal Medicine, Seoul National University Bundang Hospital, Seongnam, Korea

Requests for reprints: Yung-Jue Bang, Department of Internal Medicine and Cancer Research Institute, Seoul National University Hospital, Seoul National University College of Medicine, 28 Yongon-Dong, Chongno-Gu, Seoul 110-744, South Korea. Phone: 82-2-2072-2390; Fax: 82-2-762-9662; E-mail: bangyj{at}plaza.snu.ac.kr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Activation of protein kinase C (PKC) has been implicated in gastric carcinogenesis. Enzastaurin is an oral ATP-competitive inhibitor of the PKCβ isozyme. Although enzastaurin was initially advanced to the clinic based on its antiangiogenic activity, it is also known to have a direct effect on a variety of human cancer cells, inducing apoptosis by inhibiting the Akt signal pathway. However, data on enzastaurin for gastric cancer are limited. Therefore, this study was performed to assess the antitumor activity of enzastaurin on gastric cancer cells and to investigate the underlying antitumor mechanisms. Enzastaurin suppressed the proliferation of cultured gastric cancer cells and the growth of gastric carcinoma xenografts. Enzastaurin did not have an effect on gastric cancer cell cycle progression; however, it had a direct apoptosis-inducing effect through the caspase-mediated mitochondrial pathway. Glycogen synthase kinase 3β phosphorylation, a reliable pharmacodynamic marker of enzastaurin activity, and Akt phosphorylation were both decreased after treatment with enzastaurin. Although the p90 ribosomal S6 kinase (Rsk) was also dephosphorylated, Erk phosphorylation was not affected in the enzastaurin-treated gastric cancer cells. Enzastaurin activated Bad, one of the Bcl-2 proapoptotic proteins, through dephosphorylation at Ser112, and depletion of Bad activity resulted in resistance to enzastaurin-induced apoptosis and cytotoxicity in gastric cancer cells. These data suggest that enzastaurin induces apoptosis through Rsk-mediated and Bad-mediated pathways, besides inhibiting the Akt signal cascade. Furthermore, enzastaurin had synergistic or additive effects when combined with 5-fluorouracil, cisplatin, paclitaxel, or irinotecan. These results warrant further clinical investigation of enzastaurin for gastric cancer treatment. [Cancer Res 2008;68(6):1916–26]


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although the incidence of gastric adenocarcinoma has decreased significantly in Western countries, it is still among the most common malignancies in South America, in many former Eastern European countries, and across Asia. In Korea, according to statistics reported in 2005, gastric cancer was the most prevalent cancer in men (1). Although chemotherapy is commonly used in clinical practice, the prognosis of advanced gastric cancer is still poor and treatment is usually unsuccessful. In breast, lung, and colorectal cancers, the identification of novel molecular targets and the development of therapies specific to these targets have provided successful new approaches to treatment in clinical practice. However, targeted therapy has not been successful in the treatment of gastric cancer, and attempts to develop and apply new agents are urgently needed.

The protein kinase C (PKC) signaling pathway, which functions through serine/threonine kinase activity, plays a key role in tumor-induced angiogenesis, tumor growth, differentiation, cytokine secretion, migration, and apoptosis and is a possible target for anticancer therapy (2, 3). PKC activation contributes to tumor cell survival and proliferation and, as such, has been implicated repeatedly in the malignant progression of human cancers, such as B-cell lymphoma (4), malignant gliomas (2), and colorectal carcinomas (57). PKC is stimulated by vascular endothelial growth factor (VEGF) receptor activation and is an important mediator of VEGF, the most potent angiogenic factor identified in a variety of solid tumors (8).

Gastric cancer tumor tissue possesses a higher level of PKC activity than normal tissue (9). Two highly specific PKC inhibitors (RO-31-8220 and chelerythrine) have been shown to suppress the growth of gastric cancer cells through apoptosis induction and cell cycle quiescence (10). PKC has been implicated as having an important role in the development of invasive activity in gastric cancer (11). Recently, it was reported that the antisense targeting PKC{alpha} and PKCβ1 markedly inhibited gastric cancer cell growth and made gastric cancer cells more responsive to mitomycin C–induced or 5-fluorouracil (5-FU)–induced apoptosis (12). Given its proposed key role in tumorigenesis, PKC may be a promising target for gastric cancer growth inhibition.

Enzastaurin (LY317615.HCl), an acyclinc bisindolylmaleimide, was initially developed as an ATP-competitive selective inhibitor of PKCβ (13). In addition to its major target PKCβ, enzastaurin also potently inhibits other PKC isoforms, including PKC{delta}, PKC{varepsilon}, PKC{gamma}, and PKC{alpha} (14). Although enzastaurin was initially developed for antiangiogenic cancer therapy (15), recent preclinical studies have shown that enzastaurin has a direct effect on a variety of human cancer cells, inducing apoptosis (14, 1618). Enzastaurin was also shown to target the phosphoinositide 3-kinase (PI3K)/Akt pathway and to inhibit glycogen synthase kinase 3β (GSK3β) phosphorylation (14). Based on these promising preclinical findings, a phase I clinical study that found that enzastaurin at 525 mg once daily was the recommended dose for further clinical trials was completed. At this 525 mg daily dose, a steady-state plasma concentration of enzastaurin and its analytes reached up to 8 µmol/L, with the a mean plasma exposure of 2.2 µmol/L (3). Currently, enzastaurin is being evaluated in several phase II or phase III clinical trials.

However, the role of enzastaurin in gastric cancer remains unknown. The results of our study show that enzastaurin is cytotoxic to gastric cancer cells. These findings strongly support further clinical evaluation of enzastaurin. Furthermore, our data show that enzastaurin induces gastric cancer cell apoptosis by a mechanism not previously reported through the p90 ribosomal S6 kinase (Rsk) and Bad-mediated pathways, in addition to inhibiting the Akt signaling cascade.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Drugs and Reagents
Enzastaurin was provided by Eli Lilly Company. Other chemotherapeutic drugs were obtained as follows: 5-FU and cisplatin from Choongwae Pharma Company, paclitaxel from BMS Korea, and irinotecan from CJ Pharmaceutical Company. Enzastaurin was initially dissolved in DMSO (Sigma Chemical Co.) at a concentration of 5 mmol/L and stored in small aliquots at –20°C.

Antibodies to caspase-3, caspase-9, Erk, phosphorylated Erk, Akt, phosphorylated Akt, p90 Rsk, phosphorylated Rsk (Thr359/Ser363), GSK3β, phosphorylated GSK3β, Bad, phosphorylated Bad (Ser112), and phosphorylated Bad (Ser136) were purchased from Cell Signaling Technology. Antibodies to caspase-8 and poly(ADP-ribose) polymerase (PARP) were provided by BD PharMingen. Antibodies to Bax, Bak, Bcl-XL, Mcl-1, and cytochrome c were obtained from Santa Cruz Biotechnology. The antibody to Bcl-2 was from DakoCytomation.

Cell Lines and Culture
Human gastric cancer cell lines (SNU-1, SNU-5, SNU-16, SNU-216, SNU-484, SNU-601, SNU-620, SNU-638, SNU-668, and SNU-719) were obtained from the Korea Cell Line Bank (19) and grown in RPMI 1640 supplemented with 10% fetal bovine serum and gentamicin (10 µg/mL). All cell lines were incubated under standard culture conditions (20% O2 and 5% CO2; 37°C).

Cell Growth Inhibition Assays
Tetrazolium dye [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, MTT; Sigma] assays were used to evaluate the growth inhibitory effects of enzastaurin, as described in prior studies (20, 21). Cells were seeded on 96-well plates, incubated for 24 h, and then treated with drugs for 72 h at 37°C. After drug treatment, MTT solution was added to each well and incubated for 4 h at 37°C before the medium was removed. DMSO was then added and shaken for 30 min at room temperature. Cell viability was determined by measuring absorbance at 550 nm in a microplate reader (Spectra Classic, Tecan Co.). Experiments were performed in groups of six for each drug concentration and were repeated thrice.

Xenograft Mouse Model
To determine the in vivo activity of enzastaurin, 6-wk-old female athymic nude mice (Harlan Sprague-Dawley, Inc.) were injected s.c. in the back with SNU-16 or SNU-484 cells in 100 µL PBS. When the tumor reached 100 mm3, enzastaurin was suspended in 10% acacia (Fisher Scientific) in water and given at a dose of 75 mg/kg by oral gavage twice daily. Control groups were treated only with vehicle. Tumor burden was measured twice a week with a caliper (calculated volume = length x width x height x {pi} / 6).

Cell Cycle Analysis
Cells were washed twice in PBS, fixed in 70% ethanol, and stored at –20°C until required for analysis. Before analysis, cell suspensions were washed with PBS, digested with RNase A (50 µg/mL) for 15 min at 37°C, and then stained with propidium iodide (50 µg/mL). The cell DNA contents (10,000 cells per experimental group) were determined using a FACSCalibur flow cytometer (Becton Dickinson Biosciences) equipped with a ModFit LT program (Verity Software House, Inc.), as previously described (20).

Annexin V Binding Assay for Apoptosis
After the cells were exposed to enzastaurin for 72 h, the degree of apoptosis was assessed by the Annexin V binding assay as instructed by the manufacturer (BD PharMingen). The harvested cell suspension was incubated with Annexin V for 15 min at room temperature in the dark and then analyzed by flow cytometry, as described previously (20). Single-variable analysis, which used Annexin V–FITC only, was performed due to the self-fluorescence of enzastaurin within the propidium iodide spectrum.

Terminal Deoxyribonucleotidyl Transferase–Mediated dUTP Nick End Labeling Assay for Apoptosis
Three core tissue biopsies (4 mm in diameter) were taken from each individual paraffin-embedded tissue sample (donor blocks) and arranged in a new recipient paraffin block (tissue array block) using a trephine apparatus (Superbiochips Laboratories). Each tissue array block contained samples of all animals. Sections of 4 µm were cut from each triplicate tissue array blocks, deparaffinized, and dehydrated. Immunohistochemical detection of apoptosis was carried out using an Apoptag in situ Apoptosis Detection kit (Chemicon International) following the procedures provided by the manufacturer.

Western Blot Analysis
Cultured cells were washed with ice-cold PBS and suspended in an extraction buffer [20 mmol/L Tris-Cl (pH 7.4), 100 mmol/L NaCl, 1% NP40, 0.5% sodium deoxycholate, 5 mmol/L MgCl2, 0.1 mmol/L phenylmethylsulfonyl fluoride, 0.1 mmol/L pepstatin A, 0.1 mmol/L antipain, 0.1 mmol/L chymostatin, 0.2 mmol/L leupeptin, 10 µg/mL aprotinin, 0.5 mg/mL soybean trypsin inhibitor, and 1 mmol/L benzamidine] on ice for 15 min. Samples containing equal amounts of total protein were resolved in a SDS-polyacrylamide denaturing gel, transferred to nitrocellulose membranes, and probed with antibodies. Detection was performed using an enhanced chemiluminescence system (Amersham Pharmacia Biotech).

For total protein extraction from frozen tissue, mouse tissues frozen in liquid nitrogen after excision were powdered with mortar and pestle. Radioimmunoprecipitation assay buffer [50 mmol/L Tris-Cl (pH 8.0), 150 mmol/L NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% sodum dodecyl sulfate, 1 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride, 1 mmol/L Na3VO4, 1 mmol/L NaF, 1 µg/mL aprotinin, 1 µg/mL leupeptin, and 1 µg/mL pepstatin] was added to powdered tissue. Samples were vortexed and then incubated for 45 min on ice. Samples were homogenized and centrifuged at 14,000 x g for 10 min. Then, Western blot analysis was performed using the same method.

Analysis of Cytochrome c Release
For detecting the mitochondrial cytochrome c release into the cytosol, cells were harvested at each experimental time point, resuspended with isotonic isolation buffer [10 mmol/L HEPES, 1 mmol/L EDTA, 250 mmol/L sucrose (pH 7.6)], and collected by centrifugation. Cells were then suspended in hypotonic isolation buffer [10 mmol/L HEPES, 1 mmol/L EDTA, 50 mmol/L sucrose (pH 7.6)] and disrupted by passing through a 27-gauge needle 5 to 10 times. After adding hypertonic isolation buffer [10 mmol/L HEPES, 1 mmol/L EDTA, and 450 mmol/L sucrose (pH 7.6)] to balance the tonicity of the buffer, cells were centrifuged at 16,000 x g for 20 min, and the supernatant was used for the cytosol protein extraction.

Transfection with Small Interfering RNA
Two independent small interfering RNA (siRNA) vectors that target the DNA sequence of Bad (Bad1 AAGAAGGGACTTCCTCGCCCG, Bad 2 GACGAGTTTGTGGACTCCTTT; Qiagen Co.) were used in this experiment, and a nonspecific siRNA (nonhomologous to any known gene sequence) was used as a negative control. SNU-620 cells were transfected with these siRNAs for 4 h using the Lipofectamine Plus reagent (Invitrogen) according to the manufacturer's protocol and recovered in fresh medium containing 10% fetal bovine serum for 12 h. Cells were then treated with enzastaurin or DMSO, and the proportion of apoptotic cells (sub-G1 fraction) was determined by flow cytometry.

Analysis of Drug Combination Effects (Isobologram Analysis)
Analyses of drug interactions were performed by constructing an envelope of additivity using the isobologram method of Steel and Peckham, as described previously (21, 22). Based on available dose-response curves, the combined effects of enzastaurin and other cytotoxic chemotherapeutic agents were analyzed at IC50. Three isoeffect curves were drawn as follows.

Mode I line. When the dose of drug A is chosen, there remains an increment of effect to be produced by drug B. If two drugs were to act independently, the addition is performed by taking the increase in doses, starting from 0, that give log survivals which add up to IC50 (heteroaddition).

Mode II(A) line. When the dose of drug A is chosen, an isoeffect curve can also be calculated by taking the dose increment of drug B that gives the required contribution to the total effect up to the limit, in this case, IC50 (isoaddition).

Mode II(B) line. Similarly, when the dose of drug B is chosen, an isoeffect curve can be calculated by taking the dose increment of drug A that gives the required contribution to IC50 (isoaddition).

With combination of graded doses of drug A and a chosen dose of drug B, a single dose-response curve can be drawn. When the experimental IC50 concentration in this drug combination falls left of the envelope (Supplementary Fig. S1, point P1), the two drugs have supraadditive (synergistic) interaction. When the experimental data point is within the envelope, the combination is considered to be noninteractive (additive; Supplementary Fig. S1, point P2). Finally, when the data point is in the area to the right of the envelope, the combination is considered to be antagonistic (Supplementary Fig. S1, point P3 or point P4).

Actual IC50 values were obtained from growth inhibition curves after cancer cells were exposed to a variety of concentrations of enzastaurin or other cytotoxic agents, alone or in combination. When combined, two drugs were applied simultaneously for 72 h.

Statistical analysis. Comparison of quantification of terminal deoxyribonucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) assay or percentage of surviving cells were analyzed by two-tailed Mann-Whitney U test or Student's t test. Statistical analysis to compare tumor sizes in xenograft-bearing mice was performed with Student's two-tailed t test. Differences between groups were considered statistically significant if P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Enzastaurin suppresses gastric cancer cell proliferation in vitro and in a xenograft mouse model. Although enzastaurin was initially introduced for clinical development due to its antiangiogenic activity, it was also shown to have a direct antiproliferative effect on human tumor cells (14). We therefore evaluated the ability of enzastaurin to suppress gastric cancer cell proliferation in culture. Indeed, enzastaurin suppressed the proliferation of gastric cancer cells and showed a wide variety of IC50 values. SNU-620 cells were the most sensitive to enzastaurin (IC50, 3.56 µmol/L) and SNU-1, SNU-5, SNU-16, and SNU-484 cells had a low micromolar range of IC50 values (3.78–6.35 µmol/L). However, enzastaurin was not very cytotoxic with SNU-216 and SNU-719 with IC50 values of >250 µmol/L after 72 hours of exposure (Fig. 1A ).


Figure 1
View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Antiproliferative activity of enzastaurin in human gastric cancer cells. A, in vitro inhibition of gastric cancer cell proliferation. The effects of enzastaurin on the proliferation of a variety of human gastric cancer cell lines were determined using the MTT assay. Cells were seeded into 96-well culture plates, treated with enzastaurin for 3 d, and then treated with MTT solution for 4 h. The cell viability was determined by measuring absorbance. Points, mean of three experiments; bars, SD. B, tumor growth suppression in a xenograft mouse model of human gastric cancer. Athymic nude mice bearing SNU-484 gastric cancer xenografts were treated with 75 mg/kg enzastaurin twice daily by gavage after tumors reached a mean tumor volume of 100 mm3 (n = 6 for each group). Vehicle control-treated animals received 10% acacia on the same schedule. Tumor volume was measured twice a week using a caliper. Tumor growth was significantly suppressed by enzastaurin treatment. *, P < 0.05 as determined by Student's t test.

 
We next sought to assess the in vivo efficacy of enzastaurin using a mouse model of human gastric cancer. The phase I clinical trials for enzastaurin have shown that p.o. administration at 525 mg/d yields ~2 µmol/L mean steady-state plasma exposure of enzastaurin and its analytes (3). In the tumor xenograft-bearing mice, plasma enzastaurin concentration is ~2 µmol/L at a dose of 75 mg/kg given p.o. by gavage twice daily (14). At this dose of enzastaurin, tumor growth in the enzastaurin-treated group was significantly suppressed compared with the control group in the SNU-484 xenograft-bearing mice (P < 0.05; Fig. 1B). Enzastaurin treatment also significantly suppressed the growth of SNU-16 gastric cancer xenograft (P < 0.05; data not shown).

Enzastaurin inhibits gastric cancer cell proliferation without cell cycle specificity and induces direct apoptosis. After demonstrating that enzastaurin had antiproliferative effects on gastric cancer cells, we next sought to examine the effects of enzastaurin on cell cycle progression. The cell cycle profiles of the gastric cancer cells were analyzed, and enzastaurin was found to have little effect on the cell cycle progression of SNU-620 and SNU-484. However, the sub-G1 population increased with the passage of time and in a dose-dependent manner after enzastaurin treatment; this result suggests that enzastaurin induced apoptosis (Fig. 2A ). Protein profiling of enzastaurin-treated gastric cancer cells showed cleavage of caspase-3 and PARP. The amount of cleaved forms of these proteins increased in a time-dependent and dose-dependent manner after enzastaurin treatment (Fig. 2B, top). Consistent with these data, the Annexin V binding assay confirmed a dose-dependent enzastaurin-induced apoptosis in SNU-620 and SNU-484 cells (Fig. 2B, bottom left). Taken together, these analyses show that enzastaurin induced direct apoptosis in human gastric cancer cells in the low micromolar range (2.5–10 µmol/L) without cell cycle–specific inhibition.


Figure 2
Figure 2
View larger version (102K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. Enzastaurin inhibits gastric cancer cell proliferation without cell cycle specificity and induces direct apoptosis through a mitochondrial pathway. A, effects of enzastaurin on cancer cell cycle distributions. Gastric cancer cells (SNU-620 and SNU-484) were treated with DMSO or enzastaurin (2.5, 5, or 10 µmol/L) for the indicated times and then collected for analysis. After 72 h, the cells were fixed with 70% ethanol, stained with propidium iodide, and subjected to flow cytometric analysis. Proportions of cells in the G1, S, and G2-M phase were quantified using the ModFit LT program (Verity Software House); total percentages of G1, S, and G2-M phases are 100% in our data. The fraction of sub-G1 content was separately calculated as a percentage of total gated events. B, enzastaurin-induced apoptosis: Western blot and Annexin V binding assay. SNU-620 and SNU-484 cells were treated with DMSO or enzastaurin up to 48 h as indicated. Equal amounts of whole-cell extracts were resolved by SDS-PAGE and analyzed by Western blotting with antibodies specific for caspase-3 or PARP (Western blot analysis; top); Annexin V staining was performed in SNU-620 and SNU-484 cells treated with DMSO or enzastaurin for 72 h and then analyzed by flow cytometry. The percentage of cells stained with Annexin V–FITC increased in enzastaurin-treated gastric cancer cells (bottom left); total protein was extracted from frozen xenograft tumors. The induction of caspase-3 activation by enzastaurin was shown using Western blot analysis (bottom right). C, enzastaurin-induced apoptosis: TUNEL assay from enzastaurin-treated or control group. Apoptosis was measured in paraffin-embedded xenograft tumors, and representative images of TUNEL immunohistochemistry are shown. The number of apoptotic cells was counted. Columns, mean of TUNEL-positive cells; bars, SE. Ten fields per slide and three slides per individual animal were counted (P < 0.05 as determined by Mann-Whitney U test). D, the change of initiator caspases and release of cytochrome c from mitochondria to cytosol in enzastaurin-treated SNU-620 cells. SNU-620 cells were treated with enzastaurin for the indicated times. Equal amounts of whole-cell extracts were resolved by SDS-PAGE, and Western blot analysis was performed with antibodies specific for caspase-8 and caspase-9. Neither caspase-8 nor caspase-9 active fragments were detected (left); after incubating SNU-620 cells with DMSO or enzastaurin for 48 h, cytosolic proteins were separated and the level of cytosolic cytochrome c was determined by Western blotting (right).

 
The effects of enzastaurin therapy on tumor cell apoptosis were also examined in a xenograft mouse model (SNU-484). In Western blot analysis using protein extraction from frozen xenograft tumors, the induction of caspase-3 activation was shown in enzastaurin-treated SNU-484 xenograft-bearing mice (Fig. 2B, bottom right). We also performed TUNEL assay on paraffin-embedded xenograft tumors and used tissue arrays, which allowed direct comparison between tissues from different animal groups. The results of TUNEL assay indicated increased levels of apoptosis in enzastaurin-treated animals compared with control animals (P < 0.05; Fig. 2C).

Enzastaurin activates the mitochondrial pathway during apoptosis in gastric cancer cells. Two major apoptotic pathways, the death receptor pathway (extrinsic pathway) and the mitochondrial pathway (intrinsic pathway), have been well characterized in mammalian cells. Over the course of these pathways, activation of the death receptor first triggers caspase-8 activation, whereas the release of mitochondrial cytochrome c activates caspase-9 as an initial caspase, all of which subsequently induce the activation of effector caspases, such as caspase-3, caspase-6, and caspase-7 (23). As shown in Fig. 2B, caspase-3 was activated in gastric cancer cells, and, thus, we next examined the activation of initiator caspases (caspase-8 and caspase-9) in enzastaurin-treated SNU-620 cells. Although active fragments of caspase-8 or caspase-9 were not detected in the Western blotting, the amount of the caspase-9 proform decreased with time. This result suggests that enzastaurin-induced apoptosis is associated with the activation of caspase-9. However, the amount of the caspase-8 proform did not change after enzastaurin treatment (Fig. 2D, left). In addition, enzastaurin induced the cytochrome c release from the mitochondria to the cytosol in SNU-620 cells (Fig. 2D, right). These results show that enzastaurin treatment led gastric cancer cells to undergo apoptosis through a mitochondrial pathway.

The proapoptotic Bcl-2 family proteins (Bax and Bak) have been shown to be required for the disruption of mitochondria and intrinsic death of cancer cells, whereas the antiapoptotic Bcl-2 family proteins (Bcl-2, Bcl-XL, and Mcl-1) can prevent cell death by interfering with the action of Bax and Bak. Therefore, the change in the expression of the Bcl-2 family proteins was examined after treating the SNU-620 or SNU-484 cells with DMSO or enzastaurin. The expression levels of Bax and Bak were not changed after enzastaurin treatment in both cell lines. Enzastaurin suppressed both Bcl-2 and Bcl-XL expression at 2.5 µmol/L in the SNU-620 cells but had no effect on these proteins in the SNU-484 cells. The levels of Mcl-1 were not significantly changed at 2.5 to 5 µmol/L of enzastaurin, but were suppressed at a higher dose of enzastaurin (10 µmol/L) in both cell lines (Supplementary Fig. S2).

Enzastaurin blocks phosphorylation of Akt and p90 Rsk. We sought to examine whether pathways known to be influenced by PKC activity might be affected in gastric cancer cells by enzastaurin treatment. PKC activity has been connected to many intracellular signaling pathways, including the ras-Erk signaling axis and the PI3K/Akt pathway (14). Although Rsk is activated by Erk, Rsk can also be influenced by a PKC-dependent and Erk-independent pathway (2426). In a previous report, treatment of HCT116 colon cancer cells and U87MG glioblastoma cells with enzastaurin failed to inhibit Erk activity, but enzastaurin inhibited Akt phosphorylation in these cell lines (14). Similarly, treatment of SNU-620 and SNU-484 cells with enzastaurin did not suppress Erk activity in the Western blot analysis. By contrast, enzastaurin showed a clear concentration-dependent reduction of AktSer473 and RskThr359/Ser363 phosphorylation (Fig. 3A ). Enzastaurin also suppressed the expression of phosphorylated GSK3β, a downstream target of the Akt pathway, in both gastric cancer cell lines (Fig. 3B).


Figure 3
View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Enzastaurin suppresses Rsk and Akt phosphorylation. A and B, enzastaurin-induced Rsk, Akt, and GSK3β dephosphorylation. Whole-cell extracts were prepared from SNU-620 and SNU-484 cells treated with DMSO or enzastaurin for the indicated times and were subjected to Western blot analysis.

 
Enzastaurin induces Bad-mediated apoptosis through the Rsk pathway in gastric cancer cells. It is well known that the activation of both ras-Erk and PI3K/Akt signaling pathways promotes cancer cell survival and, along with the cell death machinery, leads to the phosphorylation and inactivation of Bad, a proapoptotic member of the Bcl-2 family proteins. Rsk can also phosphorylate Bad via a PKC-dependent and Erk-independent pathway (2426). Survival-promoting cytokines suppress the activity of the Bad protein by inducing the phosphorylation of Bad at two critical sites, Ser112 and Ser136, which leads to the dissociation of Bad from prosurvival Bcl-2 proteins and the association of Bad with members of the 14-3-3 family of proteins (27). The regulation of Bad by these phosphorylation events suggests that Bad is a point of convergence for multiple signaling pathways that cooperate in cell death or survival. Akt phosphorylates Bad on Ser136, whereas Erk or Rsk phosphorylate Bad on Ser112, respectively (2426). Because enzastaurin suppressed the phosphorylation of Akt and Rsk, we next evaluated whether Bad activity was affected in enzastaurin-treated gastric cancer cells using Western blot analysis. As shown in Fig. 4A , Ser112 phosphorylation of Bad was readily detectable and decreased in a concentration-dependent manner after enzastaurin treatment. Because Erk phosphorylation was not decreased in enzastaurin-treated cells (Fig. 3A), enzastaurin-induced Rsk dephosphorylation is thought to activate Bad via dephosphorylation of Bad at Ser112. These data suggest that activation of Bad through its dephosphorylation at Ser112 is a crucial mechanism for enzastaurin-mediated gastric cancer cell apoptosis.


Figure 4
View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Enzastaurin induces Bad-mediated apoptosis through the Rsk pathway in gastric cancer cells. A, enzastaurin-induced Bad dephosphorylation at Ser112. Whole-cell lysates of SNU-620 and SNU-484 cells after treatment of DMSO or enzastaurin for the indicated times were subjected to Western blot analysis. Bad protein phosphorylated at Ser136 was not detected in the extracts of gastric cancer cells (data not shown). B, knockdown of Bad by siRNAs. SNU-620 cells were transfected with the nonspecific control vector or siRNA vectors against Bad (Bad1 and Bad2). Immunoblotting showed a stable decrease in the total Bad expression after the transfection of Bad siRNAs. C, the change of enzastaurin-induced apoptosis after depletion of Bad expression. SNU-620 cells were transfected with the nonspecific control vector or siRNA vectors against Bad (Bad1 and Bad2). Apoptosis (sub-G1 proportion) was analyzed 48 or 72 h after DMSO or enzastaurin treatment by flow cytometry. D, the change of enzastaurin-induced cytotoxicity after depletion of Bad expression. SNU-620 cells transfected with siRNA vectors were seeded into six-well culture plates and then treated with DMSO or enzastaurin (10 µmol/L). After 72 h, surviving cell numbers were counted by hemocytometer (P < 0.05 as determined by Student's t test).

 
To confirm the direct involvement of Bad in enzastaurin-induced apoptotic cell death, we analyzed the effect of silencing endogenous Bad protein by siRNA in SNU-620 cells. Transfections of two independent siRNAs targeting Bad (Bad1 and Bad2) strongly silenced endogenous Bad, compared with transfections of nonspecific siRNA (Fig. 4B). When SNU-620 cells were transfected with Bad siRNAs, the extent of enzastaurin-induced apoptosis and cytotoxicity were markedly reduced compared with those cells transfected with the control siRNA (Fig. 4C and D). Taken together, these results suggest that enzastaurin-induced apoptosis and cytotoxicity in gastric cancer cells were mediated through Bad activation via the Rsk pathway.

Enzastaurin is also known to exert its anticancer activity by inhibiting signals through the Akt pathway (14, 17, 18); our data also showed decreased phosphorylation of Akt in enzastaurin-treated gastric cancer cells (Fig. 3A). However, although the phosphorylated Bad (Ser136) antibody readily detected the phosphorylated Bad control protein (from Cell Signaling Technology, Inc.), the Bad protein phosphorylated at Ser136 from the extracts of gastric cancer cells was not detected (data not shown). Thus, the association between the Akt pathway and the Bad activity could not be confirmed.

The combination of enzastaurin and cytotoxic chemotherapeutic drugs shows additive or synergistic activity in gastric cancer cells. The combined effects of enzastaurin and cytotoxic chemotherapeutic agents (5-FU, cisplatin, paclitaxel, and irinotecan) were tested using the isobologram method in SNU-620 and SNU-484 cells (Fig. 5 ). The simultaneous exposure of enzastaurin and these additional cytotoxic agents over a period of 72 hours produced additive or synergistic interactions.


Figure 5
Figure 5
View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. IC50 isobolograms of enzastaurin plus other chemotherapeutic agents show additive or synergistic interaction in SNU-620 and SNU-484 cells. SNU-620 (A) or SNU-484 cells (B) were exposed to various concentrations of enzastaurin or other cytotoxic agents (5-FU, cisplatin, paclitaxel, and irinotecan) for 72 h, alone or in combination, simultaneously. Left, dose-response curves of enzastaurin and other chemotherapeutics drugs. MTT assays were used to evaluate the growth-inhibitory effects of drug combinations. Right, envelopes of additivity, surrounded by solid (Figure 5), dashed (Figure 5), and dotted lines (·····), were constructed from the dose-response curves. Points, mean values for three independent experiments.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PKC is involved in signal transduction pathways that regulate growth factor response, tumor cell proliferation, and apoptosis. PKC therefore represents an attractive and promising target for cancer treatment. Although implicated in gastric cancer pathogenesis, the therapeutic value of targeting the PKC signaling pathway in gastric cancer is to date unknown. We therefore investigated the cytotoxicity and antitumor effects of enzastaurin in gastric cancer. Although SNU-216 and SNU-719 were resistant to enzastaurin, growth of other gastric cancer cells was effectively inhibited by enzastaurin. Specially, SNU-1, SNU-5, SNU-16, SNU-484, and SNU-620 had a low micromolar range of IC50 values (3.78–6.35 µmol/L; Fig. 1A); this range was similar to that of colon carcinoma, glioblastoma, prostate cancer, cutaneous T-cell lymphoma, and myeloma cell lines (14, 17, 18). When combined with cytotoxic agents commonly used in the treatment of advanced gastric cancer, enzastaurin showed synergistic or additive activities at clinically significant concentrations (1–3 µmol/L), as shown in Fig. 5. Oral dosing with enzastaurin to yield plasma concentrations similar to those achieved in clinical trials also significantly suppressed the growth of human gastric cancer cell xenografts (Fig. 1B).

To date, there is no report on the effects of enzastaurin on cancer cell cycle progression. In a previous report, stauroporine and its analogues with high specificity for PKC had differential effects on cell cycle progression in A549 lung cancer cells. Staurosporine and UCN-01 retarded A549 cells in G0-G1. However, CGP 41251 had no effect on any phase of the A549 cell cycle, as enzastaurin inhibited SNU-620 and SNU-484 cell growth in a noncycle-specific manner (Fig. 2A). These findings show that PKC inhibitors differ with respect to the mechanisms by which they interfere with the cell cycle (28). Our data suggest that enzastaurin induces in vitro cell growth inhibition in gastric cancer through direct induction of apoptosis without affecting cell cycle progression. This apoptotic induction by enzastaurin was mediated through the activation of caspases in the gastric cancer cells. The increased level of the cytosolic cytochrome c protein and the decreased level of caspase-9 proform, after enzastaurin treatment, reveal that a mitochondrial apoptotic pathway was involved in enzastaurin-induced gastric cancer cell death (Fig. 2D). Enzastaurin-induced apoptosis was also shown in tumor xenograft-bearing mice (Fig. 2B and C). In MM.1S myeloma cells, down-regulation of Mcl-1, but not Bcl-2 and Bcl-XL, was observed after enzastaurin treatment (2.5–5 µmol/L; ref. 16). However, Mcl-1 expression levels were not changed significantly at 2.5 to 5 µmol/L of enzastaurin in SNU-620 and SNU-484 cells, but its expression was suppressed at a higher dose (10 µmol/L). Both Bcl-2 and Bcl-XL expression in SNU-620 cells were decreased at lower doses of enzastaurin (2.5 µmol/L; Supplementary Fig. S2). These results show that enzastaurin affects the expression of the antiapoptotic Bcl-2 family proteins differently according to the specific cell type evaluated.

The mechanisms associated with enzastaurin-induced apoptosis in cancer cells are not clear. Recent studies have emphasized the importance of the PI3K/Akt signaling pathway in enzastaurin-induced apoptosis in human cancer cell lines. These studies showed that the expression of phosphorylated Akt and GSK3β, one of the Akt downstream targets, was decreased by enzastaurin treatment. They also suggested that GSK3β is a reliable pharmacodynamic marker for enzastaurin activity (14, 17, 18). Akt activation, which is mediated through phosphorylation, maintains a survival signal that protects cells from apoptosis by phosphorylating proapoptotic proteins, such as caspase-9, Bad, and the cell regulatory protein GSK3β; in addition to indirectly modulating p53 and nuclear factor-{kappa}B, it also mediates growth factor–induced cell proliferation (18). Therefore, suppression of Akt phosphorylation may be an important mechanism associated with enzastaurin-induced tumor cell death. However, experiments with in vitro kinase assays showed that enzastaurin caused virtually no inhibition of Akt (14). Thus, it was suggested that enzastaurin may indirectly suppress the Akt signaling pathway through its inhibitory effect on PKC proteins (14). However, the mechanisms underlying enzastaurin activity, linking the PKC and Akt pathways, are still unknown and remain to be elucidated.

In our study, the expression of both phosphorylated Akt and GSK3β was also decreased by enzastaurin treatment; this finding is consistent with previous reports. Additionally, our experiments showed a new mechanism involved in enzastaurin-induced apoptosis in gastric cancer cells—the Bad pathway. Bad is one of the proapoptotic Bcl-2 family member proteins and is inactivated by phosphorylation at two critical sites, Ser112 and Ser136. When phosphorylated at Ser112 or Ser136, Bad is complexed to the cytosolic 14-3-3 protein and fails to interact with the antiapoptotic Bcl-XL protein, thus favoring cell survival (27). In our experiments, Bad activation (dephosphorylation) was confirmed in enzastaurin-treated gastric cancer cells (Fig. 4A). In addition, the depletion of Bad conferred resistance to enzastaurin-induced apoptosis and cytotoxicity in the gastric cancer cells (Fig. 4C and D). Because Erk phosphorylation was not decreased, dephosphorylation of Bad at Ser112 is thought to be mediated by Rsk inactivation in enzastaurin-treated gastric cancer cells (2426). However, a phosphorylated Bad at Ser136, which is mediated by the Akt pathway, was not detected in our experiments. One explanation for this finding is that the expression of phosphorylated Bad at Ser136 in gastric cancer cells is below the limit of detection with the antibody we have used (from Cell Signaling Technology, Inc.). However, weak or absent phosphorylation on Ser136 might be a common phenomenon shared by diverse tumor cells. One study showed efficient Bad phosphorylation at Ser136 in normal melanocytes, whereas it was only minimally detected in melanoma cell lines, although the levels of Bad protein were similar in the two cell types (29). Another study reported a similar phenomenon (30). Thus, the association between Akt and Bad cannot be confirmed in our study; further investigation of the mechanisms underlying Akt-associated apoptotic induction in enzastaurin-treated cancer cells need to be performed. Suggesting mechanisms for enzastaurin-induced apoptosis in gastric cancer, including the newly identified Rsk-mediated and Bad-mediated pathways, are illustrated in Fig. 6 .


Figure 6
View larger version (18K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Schematic representation of mechanisms of enzastaurin-induced apoptosis in gastric cancer cells. Enzastaurin inhibits PKC activity and phosphorylation of Akt, GSK3β, Rsk, and Bad, leading to apoptotic induction and inhibition of tumor cell proliferation.

 
In summary, enzastaurin induced gastric cancer cell death via mitochondria and caspase-mediated pathways without cell cycle specificity. We showed that enzastaurin induced apoptosis in gastric cancer cells via a newly identified mechanism through Rsk-mediated and Bad-mediated pathways, in addition to the Akt signaling cascade. Furthermore, enzastaurin had synergistic or additive activity with other cytotoxic agents in gastric cancer cells. Our data provide a platform for further evaluation of the novel and orally available PKCβ inhibitor, enzastaurin, as a potential therapeutic agent for the treatment of gastric cancer.


    Acknowledgments
 
Grant support: Seoul National University Bundang Hospital Research grant 02-2007-030 and Eli Lilly Company.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

Received 8/18/07. Revised 10/22/07. Accepted 1/17/08.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Shin HR, Won YJ, Jung KW, et al. Nationwide cancer incidence in Korea, 1999-2001; first result using the national cancer incidence database. Cancer Res Treat 2005;37:325–31.
  2. da Rocha AB, Mans DR, Regner A, Schwartsmann G. Targeting protein kinase C: new therapeutic opportunities against high-grade malignant gliomas? Oncologist 2002;7:17–33.[Abstract/Free Full Text]
  3. Carducci MA, Musib L, Kies MS, et al. Phase I dose escalation and pharmacokinetic study of enzastaurin, an oral protein kinase Cβ inhibitor, in patients with advanced cancer. J Clin Oncol 2006;24:4092–9.[Abstract/Free Full Text]
  4. Shipp MA, Ross KN, Tamayo P, et al. Diffuse large B-cell lymphoma outcome prediction by gene-expression profiling and supervised machine learning. Nat Med 2002;8:68–74.[CrossRef][Medline]
  5. Gokmen-Polar Y, Murray NR, Velasco MA, Gatalica Z, Fields AP. Elevated protein kinase C βII is an early promotive event in colon carcinogenesis. Cancer Res 2001;61:1375–81.[Abstract/Free Full Text]
  6. Zhang J, Anastasiadis PZ, Liu Y, Thompson EA, Fields AP. Protein kinase C (PKC) βII induces cell invasion through a Ras/Mek-, PKC iota/Rac 1-dependent signaling pathway. J Biol Chem 2004;279:22118–23.[Abstract/Free Full Text]
  7. Liu Y, Su W, Thompson EA, Leitges M, Murray NR, Fields AP. Protein kinase CβII regulates its own expression in rat intestinal epithelial cells and the colonic epithelium in vivo. J Biol Chem 2004;279:45556–63.[Abstract/Free Full Text]
  8. McMahon G. VEGF receptor signaling in tumor angiogenesis. Oncologist 2000;5 Suppl 1:3–10.[Abstract/Free Full Text]
  9. Yasui W, Sumiyoshi H, Ochiai A, Tahara E. Calcium-activated, phospholipid-dependent protein kinase in human gastric mucosa and carcinoma. Jpn J Cancer Res 1985;76:1168–73.[Medline]
  10. Zhu GH, Wong BC, Eggo MC, Yuen ST, Lai KC, Lam SK. Pharmacological inhibition of protein kinase C activity could induce apoptosis in gastric cancer cells by differential regulation of apoptosis-related genes. Dig Dis Sci 1999;44:2020–6.[CrossRef][Medline]
  11. Schwartz GK, Jiang J, Kelsen D, Albino AP. Protein kinase C: a novel target for inhibiting gastric cancer cell invasion. J Natl Cancer Inst 1993;85:402–7.[Abstract/Free Full Text]
  12. Jiang XH, Tu SP, Cui JT, et al. Antisense targeting protein kinase C{alpha} and β1 inhibits gastric carcinogenesis. Cancer Res 2004;64:5787–94.[Abstract/Free Full Text]
  13. Faul MM, Gillig JR, Jirousek MR, et al. Acyclic N-(azacycloalkyl)bisindolylmaleimides: isozyme selective inhibitors of PKCβ. Bioorg Med Chem Lett 2003;13:1857–9.[CrossRef][Medline]
  14. Graff JR, McNulty AM, Hanna KR, et al. The protein kinase Cβ-selective inhibitor, Enzastaurin (LY317615.HCl), suppresses signaling through the AKT pathway, induces apoptosis, and suppresses growth of human colon cancer and glioblastoma xenografts. Cancer Res 2005;65:7462–9.[Abstract/Free Full Text]
  15. Keyes K, Cox K, Treadway P, et al. An in vitro tumor model: analysis of angiogenic factor expression after chemotherapy. Cancer Res 2002;62:5597–602.[Abstract/Free Full Text]
  16. Podar K, Raab MS, Zhang J, et al. Targeting PKC in multiple myeloma: in vitro and in vivo effects of the novel, orally available small-molecule inhibitor Enzastaurin (LY317615.HCl). Blood 2007;109:1669–77.[Abstract/Free Full Text]
  17. Rizvi MA, Ghias K, Davies KM, et al. Enzastaurin (LY317615), a protein kinase Cβ inhibitor, inhibits the AKT pathway and induces apoptosis in multiple myeloma cell lines. Mol Cancer Ther 2006;5:1783–9.[Abstract/Free Full Text]
  18. Querfeld C, Rizvi MA, Kuzel TM, et al. The selective protein kinase Cβ inhibitor enzastaurin induces apoptosis in cutaneous T-cell lymphoma cell lines through the AKT pathway. J Invest Dermatol 2006;126:1641–7.[CrossRef][Medline]
  19. Ku JL, Park JG. Biology of SNU cell lines. Cancer Res Treat 2005;37:1–19.
  20. Lee KW, Kim JH, Park JH, et al. Antitumor activity of SK-7041, a novel histone deacetylase inhibitor, in human lung and breast cancer cells. Anticancer Res 2006;26:3429–38.[Abstract/Free Full Text]
  21. Kim JH, Lee KW, Jung Y, et al. Cytotoxic effects of pemetrexed in gastric cancer cells. Cancer Sci 2005;96:365–71.[CrossRef][Medline]
  22. Kano Y, Suzuki K, Akutsu M, et al. Effects of CPT-11 in combination with other anti-cancer agents in culture. Int J Cancer 1992;50:604–10.[Medline]
  23. Hengartner MO. The biochemistry of apoptosis. Nature 2000;407:770–6.[CrossRef][Medline]
  24. Tan Y, Ruan H, Demeter MR, Comb MJ. p90(RSK) blocks bad-mediated cell death via a protein kinase C-dependent pathway. J Biol Chem 1999;274:34859–67.[Abstract/Free Full Text]
  25. Bertolotto C, Maulon L, Filippa N, Baier G, Auberger P. Protein kinase C{theta} and epsilon promote T-cell survival by a rsk-dependent phosphorylation and inactivation of BAD. J Biol Chem 2000;275:37246–50.[Abstract/Free Full Text]
  26. Hurbin A, Coll JL, Dubrez-Daloz L, et al. Cooperation of amphiregulin and insulin-like growth factor-1 inhibits Bax- and Bad-mediated apoptosis via a protein kinase C-dependent pathway in non-small cell lung cancer cells. J Biol Chem 2005;280:19757–67.[Abstract/Free Full Text]
  27. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ. Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell 1996;87:619–28.[CrossRef][Medline]
  28. Courage C, Snowden R, Gescher A. Differential effects of staurosporine analogues on cell cycle, growth and viability in A549 cells. Br J Cancer 1996;74:1199–205.[Medline]
  29. Eisenmann KM, VanBrocklin MW, Staffend NA, Kitchen SM, Koo HM. Mitogen-activated protein kinase pathway-dependent tumor-specific survival signaling in melanoma cells through inactivation of the proapoptotic protein bad. Cancer Res 2003;63:8330–7.[Abstract/Free Full Text]
  30. Chao OS, Clement MV. Epidermal growth factor and serum activate distinct pathways to inhibit the BH3 only protein BAD in prostate carcinoma LNCaP cells. Oncogene 2006;25:4458–69.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
J. Zhang, M. Sattler, G. Tonon, C. Grabher, S. Lababidi, A. Zimmerhackl, M. S. Raab, S. Vallet, Y. Zhou, M.-A. Cartron, et al.
Targeting Angiogenesis via a c-Myc/Hypoxia-Inducible Factor-1{alpha}-Dependent Pathway in Multiple Myeloma
Cancer Res., June 15, 2009; 69(12): 5082 - 5090.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ahn, J. Kim, M. R. Hara, X.-R. Ren, and R. J. Lefkowitz
{beta}-Arrestin-2 Mediates Anti-apoptotic Signaling through Regulation of BAD Phosphorylation
J. Biol. Chem., March 27, 2009; 284(13): 8855 - 8865.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. S. Raab, I. Breitkreutz, G. Tonon, J. Zhang, P. J. Hayden, T. Nguyen, J. H. Fruehauf, B. K. Lin, D. Chauhan, T. Hideshima, et al.
Targeting PKC: a novel role for beta-catenin in ER stress and apoptotic signaling
Blood, February 12, 2009; 113(7): 1513 - 1521.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
B. A. Teicher
In Vivo/Ex Vivo and In Situ Assays Used in Cancer Research: A Brief Review
Toxicol Pathol, January 1, 2009; 37(1): 114 - 122.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, K.-W.
Right arrow Articles by Bang, Y.-J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, K.-W.
Right arrow Articles by Bang, Y.-J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online