Cancer Research Cancer Medicine 8 EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
Cancer Research 69, 6960, September 1, 2009. Published Online First August 18, 2009;
doi: 10.1158/0008-5472.CAN-09-0863
© 2009 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow All Versions of this Article:
0008-5472.CAN-09-0863v1
69/17/6960    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Google Scholar
Right arrow Articles by Burgoyne, A. M.
Right arrow Articles by Brady-Kalnay, S. M.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burgoyne, A. M.
Right arrow Articles by Brady-Kalnay, S. M.

Experimental Therapeutics, Molecular Targets, and Chemical Biology

Proteolytic Cleavage of Protein Tyrosine Phosphatase µ Regulates Glioblastoma Cell Migration

Adam M. Burgoyne1, Polly J. Phillips-Mason1, Susan M. Burden-Gulley1, Shenandoah Robinson2, Andrew E. Sloan2, Robert H. Miller3 and Susann M. Brady-Kalnay1,3

Departments of 1 Molecular Biology and Microbiology, 2 Neurosurgery, and 3 Neurosciences, School of Medicine, Case Western Reserve University, Cleveland, Ohio

Requests for reprints: Susann M. Brady-Kalnay, Department of Molecular Biology and Microbiology, School of Medicine, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4960. Phone: 216-368-0330; Fax: 216-368-3055; E-mail: susann.brady-kalnay{at}case.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Glioblastoma multiforme (GBM), the most common malignant primary brain tumor, represents a significant disease burden. GBM tumor cells disperse extensively throughout the brain parenchyma, and the need for tumor-specific drug targets and pharmacologic agents to inhibit cell migration and dispersal is great. The receptor protein tyrosine phosphatase µ (PTPµ) is a homophilic cell adhesion molecule. The full-length form of PTPµ is down-regulated in human glioblastoma. In this article, overexpression of full-length PTPµ is shown to suppress migration and survival of glioblastoma cells. Additionally, proteolytic cleavage is shown to be the mechanism of PTPµ down-regulation in glioblastoma cells. Proteolysis of PTPµ generates a series of proteolytic fragments, including a soluble catalytic intracellular domain fragment that translocates to the nucleus. Only proteolyzed PTPµ fragments are detected in human glioblastomas. Short hairpin RNA–mediated down-regulation of PTPµ fragments decreases glioblastoma cell migration and survival. A peptide inhibitor of PTPµ function blocks fragment-induced glioblastoma cell migration, which may prove to be of therapeutic value in GBM treatment. These data suggest that loss of cell surface PTPµ by proteolysis generates catalytically active PTPµ fragments that contribute to migration and survival of glioblastoma cells. [Cancer Res 2009;69(17):6960–8]


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 
Gliomas are malignancies of glial supporting cells of the central nervous system, including astrocytes and oligodendrocytes (1, 2). These neoplasms are categorized by their putative cell of origin based on morphologic similarities to various types of normal glia (2, 3). They are graded histologically between 1 and 4 according to the WHO classification system of tumor cellularity, proliferation, angiogenesis, and invasiveness (4). Glioblastoma multiforme (GBM), a WHO grade 4 glioma, has a poor prognosis with a mean survival time of <1 year (5). The lethality of GBM can be attributed to the dispersive phenotype where cells migrate and develop foci throughout the brain (3, 6, 7). We recently showed that the receptor protein tyrosine phosphatase µ (PTPµ) negatively regulates GBM cell migration, and full-length PTPµ protein is lost in human GBM tumors in comparison with low-grade astrocytomas (8).

PTPµ is the prototype of the type IIb subfamily of receptor PTPs (RPTP). PTPµ has been shown to participate in homophilic binding. PTPµ on the extracellular surface of one cell binds to PTPµ on the surface of an adjacent cell (9–11). As a transmembrane adhesion receptor, PTPµ has the ability to sense an extracellular signal via its extracellular segment and transduce this signal intracellularly via its phosphatase activity (12–14). The PTPµ extracellular domain is composed of a MAM (meprin/A5-protein/PTPµ) domain, an immunoglobulin-like (Ig) domain, and four fibronectin type III (FNIII) repeats (12, 15, 16). The intracellular domain of PTPµ contains a juxtamembrane sequence with homology to cadherins and two phosphatase domains of which only the membrane proximal is catalytically active (17, 18). The juxtamembrane portion contains a helix-loop-helix wedge-shaped motif (14) that was targeted in the design of a peptide inhibitor of PTPµ function. This wedge peptide inhibitor specifically blocks PTPµ function in migration assays (19, 20).

PTPµ is expressed as a 200-kDa protein that is proteolytically cleaved in the fourth FNIII repeat, resulting in a 100-kDa extracellular fragment (E-subunit) that remains associated with the 100-kDa transmembrane and intracellular portion (P-subunit) through a noncovalent interaction (11, 21, 22). This cleavage is mediated by a furin-like protease in the endoplasmic reticulum during intracellular trafficking (21). Another type IIb RPTP, PTP{kappa}, is also cleaved by a furin-like protease and further processed by an {alpha}-secretase of the ADAM (a disintegrin and metalloproteinase domain) family and a {gamma}-secretase (23). The extracellular ADAM cleaves the P-subunit adjacent to the membrane to generate P{Delta}E and shed the ectodomain (23). This cleavage primes PTP{kappa} P{Delta}E to be cleaved by {gamma}-secretase, which releases the intracellular portion of PTP{kappa} containing the active phosphatase domain from the membrane (23). The intracellular fragment of PTP{kappa} translocates to the nucleus and controls β-catenin transcription (23). We previously observed a similar fragment of PTPµ containing the catalytically active intracellular domain (ICD) in the nucleus of a lung cell line (24).

We have previously shown that PTPµ protein is down-regulated in glioblastoma (8). Here, we show that overexpression of full-length PTPµ in glioblastoma cells suppresses cell migration and growth factor–independent cell survival. In addition, we propose that PTPµ down-regulation in glioblastoma is the result of sequential cleavage of full-length PTPµ protein to generate the fragments P{Delta}E and ICD. In support of this hypothesis, the intracellular fragments of PTPµ are present in human glioblastoma samples and glioblastoma xenograft flank tumors. Surprisingly, short hairpin RNA (shRNA)–mediated down-regulation of PTPµ fragments decreases cell migration and growth factor–independent survival in glioblastoma cells. Furthermore, peptide inhibition of the function of PTPµ fragments inhibits cell migration. These data suggest that proteolytic cleavage of full-length PTPµ generates PTPµ fragments that regulate cell migration and growth factor–independent survival in glioblastoma. These PTPµ fragments can be targeted to develop novel therapeutic agents for glioblastoma patients.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 Disclosure of Potential...
 References
 
Cell lines. The human GBM cell lines U-87 MG and LN-229 were obtained from the American Type Culture Collection. Human Gli36{Delta}5 glioblastoma cells have been described (25).

Lentiviral transduction. A human full-length PTPµ cDNA construct in pMT2 has been described (26). Full-length PTPµ was ligated into the lentiviral expression vector pCDH-MCS2 (System Biosciences). A full-length PTPµ-green fluorescent protein (GFP) fusion construct has been described (27). The PTPµ-GFP cassette was subcloned into pCDH-MCS2. An intracellular PTPµ-GFP fusion construct corresponding to PTPµ ICD has been described (24). Lentiviral shRNA constructs and the production of VSV-G–pseudotyped lentiviral particles have been described (8).

Immunoblotting. Cell lysates were prepared and immunoblotted as described (8) using normalized samples of ~20 µg protein detected with monoclonal antibodies recognizing the intracellular segment of PTPµ (SK-7 or SK-18; ref. 28). An antibody against vinculin was from Sigma-Aldrich. The GFP antibody JL-8 was from Clontech.

Reverse transcription-PCR. Reverse transcription-PCR (RT-PCR) was performed as described (8). The PCR primers were as follows: extracellular, CGCGAATTCTAGAGACGTTCTCAGGTGGC (forward) and CCCGCAAGCTTACTTCTTCTCGCACTTG (reverse); intracellular, CGCGGATCCAAAGAGACCATGAGCAGCACCCGA (forward) and CCGGAATTCTCATCTGTTC-TCATCTTTCTTAGCCGA (reverse).

Scratch wound assay. Scratch wound assays were performed as described (8). Confluent monolayers of cells were scratched to induce a wound and analyzed by microscopy for the distance migrated by the leading edge of the wound at 0 and 24 h.

Colony formation assays. Growth factor–independent clonogenic colony assays were performed as described (29). Crystal violet–stained colonies were imaged with the Quantity One imaging software of the Gel Doc imaging system (Bio-Rad). Images were quantitated using MetaMorph software (Molecular Devices) by measuring the thresholded area of each well to include only colonies. For the soft agarose assay, cells were seeded at a concentration of 75,000/mL in 0.4% agarose and plated on an underlay of 0.8% agarose in a six-well plate. Colonies were analyzed after 4 wk by imaging Z-stacks of 20 random 10x fields using a Leica DMI6000B automated inverted microscope (Leica Microsystems GmbH) attached to a Retiga EXi camera (QImaging). The number of colonies in minimized Z-stacks from each microscope field was recorded.

Biotinylation of cell surface proteins. Cell surface biotinylation was performed using a Sulfo-NHS-SS-Biotin kit (Pierce). Biotinylated proteins were isolated and resolved by SDS-PAGE on 6% gels followed by immunoblotting with an antibody to PTPµ (SK-18) as described (30).

Inhibitors. The furin inhibitor I (Dec-RVKR-CMK; Calbiochem) was used at 50 µmol/L for 17 to 20 h. The {gamma}-secretase inhibitors DAPT (Sigma-Aldrich) and L685,458 (Sigma-Aldrich) were used at 2 and 5 µmol/L, respectively, for 17 to 20 h. The proteasome was inhibited with MG132 (Sigma-Aldrich) at 20 µmol/L or epoxomicin (Calbiochem) at 5 µmol/L for 4 h. GM6001 (Calbiochem) was used at 50 µmol/L as a matrix metalloproteinase (MMP)/ADAM inhibitor for 17 to 20 h. Inhibitors were reconstituted in DMSO, which was used as a vehicle control. An inhibitor of PTPµ function targeting the helix-loop-helix wedge domain has beenshown to inhibit PTPµ function (19, 20). The PTPµ wedge peptide and a scrambled control peptide were synthesized to include a membrane-penetrant Tat-derived sequence at the COOH terminus to promote cellular uptake. Peptides synthesized by Genemed Synthesis or GenScript were reconstituted in water and added to cells at a final concentration of 5 µmol/L.

Immunoprecipitations. Cells were grown to confluence, treated with inhibitors, and lysed in 20 mmol/L Tris-HCl (pH 7.5), 1% Triton X-100, 150 mmol/L NaCl, 2 mmol/L EDTA, 1 mmol/L benzamidine, 5 µg/mL aprotinin, 5 µg/mL leupeptin, and 1 µg/mL pepstatin. Samples were sonicated and centrifuged at 10,000 rpm for 5 min. Immunoprecipitations from ~400 µg total protein were performed as described (27) using a PTPµ antibody (SK-18) and resolved by SDS-PAGE on 8% gels followed by immunoblotting with an antibody to PTPµ (SK-7).

Immunocytochemistry. Immunofluorescent cell staining was performed as described (24). Fixed cells were probed with SK-7 or SK-18, which recognize intracellular PTPµ, and detected with goat anti-mouse Alexa Fluor 488 secondary antibody (Molecular Probes, Invitrogen). Slides were mounted with Citifluor antifadent mounting medium (Electron Microscopy Sciences) and imaged using the Leica system described above.

Tumor specimens. Fresh human brain and tumor tissues were obtained from surgical resections in accordance with an approved protocol from the University Hospitals Case Medical Center Institutional Review Board. GBM specimens of ~100 mg each were obtained for protein extraction. Noncancerous, noneloquent, cortical brain was also collected.

GBM xenograft tumors were grown in NIH athymic nude female mice in accordance with an approved protocol from the Case Western Reserve University Institutional Animal Care and Use Committee. LN-229 or Gli36{Delta}5 cells (2 x 106) were resuspended in a 1:1 dilution of Matrigel (BD Biosciences) in PBS and injected s.c. in the right flank region of the mouse. Tumors were harvested between 9 and 28 d after injection. Lysates of human and xenograft tumor specimens were prepared as described (8). Tumor samples were homogenized using a tissue tearor homogenizer or a 2 mL Dounce homogenizer. Cleared lysates (~20 µg from human samples and ~50 µg from xenograft samples) were analyzed by immunoblot on 8% gels with an antibody to PTPµ (SK-18).

Statistics. Data presented represent at least three independent experiments. Replicates were normalized as a percent of the control, and the means were plotted using Microsoft Excel. Error bars indicate SE. Data were analyzed for statistical significance using an unpaired Student's t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 Disclosure of Potential...
 References
 
PTPµ protein is down-regulated in the human glioblastoma cell line LN-229. We recently showed that PTPµ is endogenously expressed in the human GBM cell line U-87 MG and that shRNA-mediated down-regulation of PTPµ in U-87 MG cells promotes cell migration and dispersal (8). Furthermore, PTPµ protein is down-regulated in human GBM tumors and the migratory human GBM cell line LN-229. In the current study, PTPµ was overexpressed in LN-229 cells via a lentiviral construct, and both the full-length and normally produced P-subunit were detected by immunoblotting with an intracellular antibody to PTPµ (Fig. 1A ). Lentiviral overexpression of PTPµ generated doublets at molecular weights corresponding to both full-length and P-subunit PTPµ (Fig. 1A). These doublets likely are due to posttranslational modifications. mRNA expression of PTPµ was examined by RT-PCR in both U-87 MG and LN-229 cells. U-87 MG cells expressed PTPµ transcript as expected. Surprisingly, PTPµ transcript was also detected in LN-229 cells despite their lack of PTPµ protein expression (Fig. 1B). PTPµ shRNA down-regulated PTPµ transcript but did not affect control glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Fig. 1C). These data suggest that the down-regulation of PTPµ in glioblastoma is due to a posttranscriptional mechanism.


Figure 1
View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. PTPµ expression is posttranscriptionally regulated. A, lysates from U-87 MG cells, parental LN-229 cells, and LN-229 cells overexpressing PTPµ were analyzed by immunoblotting. PTPµ was detected using an antibody to the ICD (SK-18) that recognizes both the full-length (FL; 200 kDa) protein and the furin-cleaved intracellular P-subunit (P; 100 kDa). U-87 MG cells express PTPµ, but LN-229 cells down-regulated PTPµ protein. PTPµ was overexpressed in LN-229 cells. Vinculin (117 kDa) was used as a loading control. B, RT-PCR analysis of LN-229 and U-87 MG mRNA indicated that PTPµ mRNA is expressed in both cell lines when compared with the PCR product of a control PTPµ-containing plasmid with primers derived from both the extracellular and ICDs. Size is indicated in base pairs. C, PTPµ shRNA but not control shRNA down-regulated PTPµ transcript; however, there was no change in GAPDH mRNA.

 
Overexpression of PTPµ suppresses cell migration and growth factor–independent cell survival. We showed recently that shRNA-mediated down-regulation of endogenous PTPµ in U-87 MG cells promotes cell migration (8). Based on these data, we hypothesized that overexpression of PTPµ in LN-229 cells would suppress cell migration. We evaluated this hypothesis using a scratch wound assay. Confluent monolayers of LN-229 cells overexpressing either vector or PTPµ were scratched to form a wound. After 24 hours, control LN-229 cells at the leading edge of the wound migrated an average of 150 µm (Fig. 2A ). However, LN-229 cells overexpressing PTPµ had impaired migration with a 3-fold reduction in the distance migrated (Fig. 2A). Additionally, overexpression of PTPµ induced a morphologic change in LN-229 cells and made the cells noticeably elongated (Fig. 2A). Because this assay occurred over 24 hours, it was possible that changes in cell proliferation could account for the difference in wound size. To rule out this possibility, LN-229 cells infected with vector or PTPµ were labeled with propidium iodide and analyzed by flow cytometry. Flow cytometry revealed no significant changes in cell proliferation between the vector- and PTPµ-infected cells (data not shown). Therefore, we concluded that the difference in wound size was due to a decrease in migration resulting from PTPµ overexpression, indicating that PTPµ suppresses migration of LN-229 glioblastoma cells.


Figure 2
View larger version (73K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. Overexpression of PTPµ suppresses glioblastoma cell migration and growth factor–independent survival. A, confluent monolayers of LN-229 cells expressing vector or PTPµ were scratched and imaged at 0 and 24 h. Dashed lines, position of the wounded edge at 0 h. Scale bar, 200 µm. *, statistically significant 3-fold reduction in migration (P < 0.0001, n = 4). B, LN-229 cells expressing vector or PTPµ were deprived of growth factor stimulation and allowed to form colonies. *, statistically significant 2-fold reduction in colony formation (P < 0.0001, n = 3).

 
Growth factor–independent survival is a hallmark of tumorigenesis. To assess the effect of PTPµ overexpression on growth factor–independent survival, a colony formation assay was used. After 2 weeks of growth factor deprivation, control LN-229 cells formed abundant colonies (Fig. 2B). In contrast, overexpression of PTPµ reduced colony formation by 2-fold (Fig. 2B). Therefore, PTPµ overexpression suppresses migration in two-dimensional culture and reduces growth factor–independent survival in three-dimensional culture of glioblastoma cells.

Proteolysis of PTPµ contributes to its down-regulation in glioblastoma. Other receptor tyrosine phosphatases are sequentially cleaved by a furin-like protease, an ADAM-type MMP, and a {gamma}-secretase to release a soluble intracellular fragment (23, 31, 32). Because GBMs are known to have up-regulated proteases (33), we hypothesized that constitutive proteolysis of PTPµ may be the mechanism of PTPµ down-regulation in GBM. We first determined whether full-length PTPµ could be detected in parental LN-229 cells. Because we cannot detect PTPµ in a total cell lysate of parental LN-229 cells, we biotinylated cell surface proteins and used avidin resin to enrich the pool of biotinylated cell surface proteins. Despite the lack of PTPµ in the total cell lysate, the biotinylated cell surface fraction contained trace amounts of PTPµ (Fig. 3A ). PTPµ is cleaved by a furin-like protease to generate the E- and P-subunits of PTPµ (11, 21, 22). As expected, treatment of cells with an inhibitor of furin activity resulted in an accumulation of full-length PTPµ (200 kDa) at the cell surface. These data imply that there is a trace amount of endogenous PTPµ in LN-229 cells that is processed by proteolysis. Biotinylation of cell surface proteins from LN-229 cells overexpressing PTPµ showed a similar pattern of full-length PTPµ accumulation at the cell surface on furin inhibition (Fig. 3A).


Figure 3
View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. PTPµ is proteolytically processed to release a catalytically active intracellular fragment from the membrane. A, lysates from parental LN-229 cells and LN-229 cells overexpressing PTPµ were biotinylated and immunoblotted for PTPµ with an antibody against the intracellular segment of PTPµ (SK-18). Trace amounts of PTPµ protein were detected in cell surface–labeled LN-229 cells. Treatment with an inhibitor of furin prevented P-subunit formation. B, LN-229 cells treated with protease inhibitors were immunoprecipitated with SK-18 and immunoblotted with an antibody against the juxtamembrane domain of PTPµ (SK-7). Proteolyzed membrane-associated (P{Delta}E) and soluble (ICD) fragments of PTPµ were stabilized with {gamma}-secretase (DAPT) and proteasome (MG132) inhibitors. C, lysates from LN-229 cells treated with specific protease inhibitors and overexpressing PTPµ or PTPµ-GFP were immunoblotted with SK-7 and GFP antibodies, respectively. PTPµ P{Delta}E and ICD were stabilized with {gamma}-secretase (DAPT and L685,458) and proteasome (MG132 and epoxomicin) inhibitors. Vinculin was used as a loading control. D, PTPµ is sequentially cleaved by a furin-like protease, an {alpha}-secretase (ADAM-type MMP), and a {gamma}-secretase to generate a membrane-free ICD that translocates to the nucleus.

 
After furin cleavage, PTP{kappa}, another PTPµ subfamily member, is subsequently cleaved by {alpha}- and {gamma}-secretases (23). We hypothesized that PTPµ is cleaved similarly. To test this hypothesis, LN-229 cells were treated with inhibitors of {alpha}- and {gamma}-secretases. Proteasome inhibitors were used for biochemical detection to prevent rapid degradation of these fragments (23). Because we cannot detect PTPµ in whole-cell lysates, the PTPµ fragments were immunoprecipitated from LN-229 cells treated with inhibitors using antibody to the intracellular domain of PTPµ. The {gamma}-secretase inhibitor DAPT stabilized a fragment that corresponds by molecular weight to a membrane-tethered truncated P-subunit termed P{Delta}E (Fig. 3B). Treatment with the proteasome inhibitor MG132 led to the accumulation of both P{Delta}E and a soluble fragment termed PTPµ ICD (Fig. 3B). The MMP inhibitor GM6001 limited the formation of PTPµ P{Delta}E and ICD fragments, indicating that cleavage by a MMP is required for subsequent processing (Fig. 3B). MG132 has been reported to inhibit {gamma}-secretase activity in addition to proteasome activity, leading to the accumulation of {alpha}- and {gamma}-secretase products (23, 34). Subsequent experiments included a more specific proteasome inhibitor, epoxomicin, to distinguish these events. Overall, these data support our hypothesis that the endogenous PTPµ expressed in LN-229 cells is constitutively cleaved to generate PTPµ P{Delta}E and ICD. Consequently, little full-length PTPµ is present to function at the cell surface in LN-229 cells.

Total cell lysates from LN-229 cells overexpressing PTPµ showed a similar pattern of cleavage products on inhibitor treatment (Fig. 3C). Stabilization of PTPµ ICD with treatment of epoxomicin confirmed that this fragment is labile and can only be seen when stabilized by the addition of a proteasome inhibitor. Treatment with MG132 and {gamma}-secretase inhibitors (DAPT and L685,458) showed accumulation of PTPµ P{Delta}E and ICD (Fig. 3C). To verify if the cleavage products include the COOH terminus of the ICD of PTPµ, we overexpressed a PTPµ construct with a COOH-terminal GFP-tag (PTPµ-GFP) in LN-229 cells. Cells expressing PTPµ-GFP were treated with inhibitors as above, and total cell lysates were immuno-blotted with GFP to detect the PTPµ-GFP fragments. A GFP antibody detected a similar pattern of fragments, suggesting that PTPµ P{Delta}E and ICD fragments include the COOH terminus of PTPµ (Fig. 3C). These data support the model depicted in Fig. 3D. Full-length PTPµ is cleaved by a furin-like protease to generate the E- and P-subunits in "normal" proteolytic processing. Cleavage by an ADAM-type MMP ({alpha}-secretase) in GBM cells generates PTPµ P{Delta}E. Subsequently, P{Delta}E is cleaved by {gamma}-secretase to generate PTPµ ICD.

PTPµ ICD is a soluble fragment that translocates to the nucleus in another cell type (24). To determine the subcellular localization of PTPµ ICD in glioblastoma cells, we performed immunocytochemistry on LN-229 cells. Antibodies recognizing the juxtamembrane (SK-7) and first phosphatase (SK-18) domains of PTPµ detected an endogenous PTPµ species with a nuclear pattern of localization similar to DAPI (4',6-diamidino-2-phenylindole)–stained nuclei (Fig. 4A ). The epitopes of these antibodies suggest that this species is PTPµ ICD. Overexpression of GFP-tagged PTPµ ICD also localized to the nucleus and confirmed these findings. In contrast, overexpression of GFP-tagged full-length PTPµ resulted in a cell-cell contact and filopodial staining pattern as reported previously (35). Full-length PTPµ likely senses extracellular adhesive cues to suppress migration by contact inhibition, whereas PTPµ ICD distributes to the cytoplasm and nucleus. These data suggest that full-length PTPµ and PTPµ ICD have distinct localization patterns, potentially leading to differences in their downstream signaling.


Figure 4
View larger version (84K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4. PTPµ ICD localizes to the nucleus, and P{Delta}E and ICD are expressed in human glioblastoma tumors and glioblastoma xenografts. A, LN-229 cells expressing endogenous ICD were analyzed by immunocytochemistry using intracellular antibodies to PTPµ (SK-7 and SK-18). LN-229 cells overexpressing GFP-tagged PTPµ ICD or full-length PTPµ were also examined. Scale bar, 20 µm. B, PTPµ expression in human normal brain and glioblastoma tissue from four patients was analyzed by immunoblotting with SK-18. Vinculin was used as a loading control. C, PTPµ P{Delta}E and ICD expression was analyzed in LN-229 and Gli36{Delta}5 xenografts from mouse flank by immunoblotting with SK-18. A human GBM tumor (T) was loaded at the end for comparison. Vinculin was used as a loading control. The human GBM tumor specimen was loaded with 2-fold less protein, as its PTPµ P{Delta}E and ICD expression is significantly higher than that of the xenograft specimens (see vinculin lane).

 
Intracellular fragments of PTPµ are expressed in human glioblastoma tumors and glioblastoma xenograft tumors. We previously showed that PTPµ protein expression is down-regulated in human GBM tumor samples (8). However, immunoblotting fresh GBM tumor tissue lysates on higher percentage gels indicated that fragments of PTPµ corresponding to PTPµ P{Delta}E and ICD are expressed in human GBM tumor samples in comparison with normal brain tissue from the same patient (Fig. 4B). Full-length PTPµ was undetectable in these GBM tumor samples (Fig. 4B). PTPµ P{Delta}E and ICD were identified in normal tissue samples that retain significant expression of full-length PTPµ (Fig. 4B). Therefore, it is the expression of full-length PTPµ that differs between normal brain and GBM tumor tissue. Normal brain tissue expresses full-length PTPµ, whereas GBM tumor tissue does not express full-length PTPµ but retains PTPµ P{Delta}E and ICD.

Neither full-length PTPµ nor PTPµ P{Delta}E and ICD are detectable in LN-229 total cell lysates by immunoblot. We assessed human GBM cell line tumor xenografts grown in mouse flanks to determine if the three-dimensional architecture of the tumor would stabilize PTPµ fragments in the GBM cells. Flank tumor lysates from LN-229 xenografts expressed little detectable full-length PTPµ but expressed abundant PTPµ P{Delta}E and ICD (Fig. 4C). Similar results were obtained using xenografts prepared with another glioma cell line, Gli36{Delta}5 (Fig. 4C). These data suggest that the three-dimensional human glioblastoma tumors and in vivo glioblastoma tumor models favor PTPµ proteolysis and stabilize PTPµ ICD and its precursor, P{Delta}E, in vivo.

PTPµ fragments contribute to glioblastoma cell migration and both growth factor–independent and anchorage-independent cell survival. PTPµ ICD is a soluble fragment generated from P{Delta}E that translocates to the nucleus (Fig. 4A). PTPµ ICD contains the catalytic domain of PTPµ and has the potential to signal differently than that of membrane-bound, cell surface–associated PTPµ due to changes in substrate availability in different cellular compartments. Overexpression of membrane-bound, cell surface–associated PTPµ suppressed GBM cell migration and growth factor–independent survival (Fig. 2). We hypothesized that PTPµ ICD and its precursor, P{Delta}E, may signal differently and affect the migration and growth factor–independent survival of GBM cells. First, the effect of PTPµ fragments on cell migration was analyzed using a scratch wound assay.

PTPµ mRNA is expressed in LN-229 cells, but the only detectable proteins are PTPµ fragments (Fig. 4). Therefore, we were able to use shRNA to down-regulate PTPµ fragments. Confluent monolayers of LN-229 cells expressing either control or two different PTPµ shRNA constructs were scratched and allowed to migrate (Fig. 5A ). Down-regulation of PTPµ fragments by both shRNA constructs suppressed cell migration by 2-fold (Fig. 5A). To rule out changes in cell proliferation, LN-229 cells infected with control or PTPµ shRNA were labeled with propidium iodide and analyzed by flow cytometry. No significant changes in cell proliferation were detected (data not shown).


Figure 5
View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 5. PTPµ fragments contribute to glioblastoma cell migration and both growth factor–independent and anchorage-independent cell survival. A, confluent monolayers of LN-229 cells expressing control or PTPµ shRNA constructs were scratched and imaged at 0 and 24 h. Dashed lines, position of the wounded edge at 0 h. Scale bar, 200 µm. *, statistically significant reduction in migration (PTPµ shRNA #1, n = 4; PTPµ shRNA #2, n = 6; P < 0.05). B, LN-229 cells expressing control or PTPµ shRNA were deprived of growth factor stimulation and allowed to form colonies. *, statistically significant reduction in colony formation (P < 0.001, n = 2). C, colonies of LN-229 cells expressing control or PTPµ shRNA were allowed to form in soft agarose over 4 wk. *, statistically significant reduction in colony formation (P < 0.0001, n = 20).

 
Both PTPµ P{Delta}E and ICD are partially stabilized by the {gamma}-secretase inhibitor DAPT and are not formed when ADAMs are inhibited (Fig. 3B). These inhibitors were used in a scratch wound assay to analyze their effects on PTPµ fragment–mediated cell migration. Stabilization of PTPµ fragments with DAPT increased migration, and prevention of PTPµ fragment formation by GM6001 decreased migration (Supplementary Fig. S1). These data suggest that proteolysis of PTPµ promotes LN-229 cell migration.

Because PTPµ overexpression affected growth factor–independent cell survival, we hypothesized that PTPµ fragments may also affect cell survival. To test this hypothesis, LN-229 cells expressing control or PTPµ shRNA were seeded at low density and allowed to form colonies over 2 weeks (Fig. 5B). Down-regulation of PTPµ fragments via shRNA reduced the number of colonies in comparison with control cells by 3-fold (Fig. 5B). These findings were confirmed in a soft agarose assay for anchorage-independent survival. PTPµ shRNA reduced the number of colonies in this assay by 5-fold (Fig. 5C). These data suggest that PTPµ fragments promote both cell migration and growth factor–independent survival of glioblastoma cells.

Catalytic activity of PTPµ fragments is required for glioblastoma cell migration. Soluble intracellular PTPµ has been shown to retain catalytic activity (24, 28). To examine whether the catalytic activity of PTPµ fragments is important in the regulation of cell migration, PTPµ function was inhibited using a PTPµ-specific peptide inhibitor (19). Confluent monolayers of LN-229 cells were treated with a membrane-penetrant PTPµ wedge peptide or a control scrambled peptide before scratching to induce a wound (Fig. 6 ). The PTPµ wedge peptide significantly reduced migration of LN-229 cells (Fig. 6). This suppression is likely due to inhibition of the signaling of the PTPµ fragments as they are the only detectable PTPµ protein stabilized in LN-229 cells (Fig. 4). These data suggest that PTPµ fragments must be catalytically active to induce GBM cell migration. Therefore, the wedge peptide inhibitor of PTPµ may have therapeutic value in the treatment of human glioblastoma.


Figure 6
View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 6. PTPµ fragment–induced migration of glioblastoma cells is abrogated by a peptide inhibitor of PTPµ function. Confluent monolayers of LN-229 cells were treated with the PTPµ wedge inhibitor peptide or a scrambled control, scratched to form a wound, and imaged at 0 and 24 h. Dashed lines, position of the wounded edge at 0 h. Scale bar, 200 µm. *, statistically significant difference in migration (P < 0.02, n = 6).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
Disclosure of Potential...
 References
 
Down-regulation of PTPµ in a human glioblastoma cell line that expresses PTPµ was reported to induce cell migration and dispersal (8). In this study, we show that overexpression of PTPµ suppresses migration and growth factor–independent survival of glioblastoma cells. Furthermore, down-regulation of PTPµ in GBM is due to proteolytic processing into a series of fragments. Human glioblastoma tumor samples selectively retain PTPµ fragments, both ICD and its precursor, P{Delta}E, in comparison with patient-matched normal brain tissue. In the absence of full-length PTPµ, this PTPµ fragment signal promotes cell migration and growth factor–independent survival. The balance of full-length PTPµ and PTPµ fragment signaling is likely important in regulating the contact inhibition switch between cell adhesion and cell migration.

The receptor tyrosine phosphatases PTP{kappa}, PTP{zeta}/β, and LAR are regulated by sequential proteolysis (23, 31, 32). Furthermore, other transmembrane receptors, such as Notch, are similarly cleaved. Notch signaling is regulated by sequential cleavage by furin, ADAMs, and {gamma}-secretase that ultimately generates an intracellular fragment (36). This fragment translocates to the nucleus and regulates the CBF1 transcription complex to control cellular processes such as differentiation and tumorigenesis (37). This regulation of cell surface receptors by proteolysis during development might be recapitulated during tumorigenesis as GBM cells have dedifferentiated, stem cell–like characteristics (3).

Differences in full-length PTPµ and PTPµ fragment signaling likely depend on the availability of PTPµ binding partners and downstream effectors. Furthermore, as a homophilic cell adhesion molecule, it may be that cell surface PTPµ and PTPµ fragment signaling pathways regulate the adhesive versus migratory switch of contact-inhibited or dispersive cells, respectively. Cell surface PTPµ binds and regulates cadherins and catenins (12), key components of classic adherens junctions. Four classic cadherin subtypes, E-, N-, R-, and VE-cadherin, associate with PTPµ (35, 38–40). The cadherin binding partner p120-catenin (p120) has been implicated as a PTPµ binding partner and substrate (41) and contributes to tumorigenesis by regulating cell migration (42). p120 can translocate to the nucleus and associate with the transcription factor Kaiso (43). Interestingly, a proteolytically cleaved intracellular fragment of E-cadherin requires p120 for its nuclear translocation (44). The cytoplasmic domain of N-cadherin can also be proteolytically processed and translocate to the nucleus (45). p120 is involved in the recruitment of {gamma}-secretase to N-cadherin for its cleavage (46). It is interesting to speculate that PTPµ fragments generated from the proteolytic cleavage of PTPµ may regulate a nuclear complex of N-cadherin and p120 given that PTPµ interacts with cadherins and p120 via its ICD (35, 41). Computer-based searches for a canonical nuclear localization sequence (NLS) in PTPµ were unsuccessful. However, both p120 and another PTPµ-interacting protein, BCCIP (24), contain NLS motifs (47, 48). The yeast homologue of BCCIP has been shown to regulate nuclear export (49). Therefore, p120 and BCCIP may aid in the shuttling of PTPµ ICD in and out of the nucleus.

Migration and dispersal of glioblastoma cells remains a clinical problem due to the lack of effective specific therapies (1–3). Individual glioblastoma cells migrate and disperse throughout the brain parenchyma to form new foci. These cells must have elevated growth factor–independent survival signaling to evade anoikis-mediated cell death and to clonally expand. Therefore, it is interesting that both migration and growth factor–independent survival pathways are regulated by PTPµ fragments. Furthermore, a peptide inhibitor targeting PTPµ fragment function reduces cell migration. A small-molecule inhibitor that mimics this peptide will be developed to target PTPµ fragments and suppress glioblastoma cell migration and dispersal in vivo. Such an advance in the field of targeted therapeutics would fulfill a vast need for specific therapy in glioblastoma treatment.


   Disclosure of Potential Conflicts of Interest
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
References
 
No potential conflicts of interest were disclosed.


   Acknowledgments
 
Grant support: NIH grant R01-NS051520 (S.M. Brady-Kalnay, S. Robinson, and R.H. Miller); National Cancer Institute grants K08-CA101954 and R01-CA116257, Ivy Brain Tumor Foundation, and Cancer Genome Atlas Project (A.E. Sloan); and NIH grants T32-GM007250 (Medical Scientist Training Program) and T32-CA059366 (A.M. Burgoyne). Additional support was obtained from the Visual Sciences Research Center Core Grant P30-EY11373 and the Case Comprehensive Cancer Center Core Grant P30-CA043703 from the NIH.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Dr. Moonkyung Caprara, Carol Luckey, and Theresa Gates for technical support; Sara Lou and Scott Howell for help with figures and graphs; and members of the Brady-Kalnay lab for insightful discussions.


   Footnotes
 
Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

This article is dedicated to Tabitha Yee-May Lou who recently lost her battle with glioblastoma.

Received 3/ 5/09. Revised 6/17/09. Accepted 6/23/09.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Disclosure of Potential...
 References
 

  1. Louis DN. Molecular pathology of malignant gliomas. Annu Rev Pathol 2006;1:97–117.[CrossRef][Medline]
  2. Wen PY, Kesari S. Malignant gliomas in adults. N Engl J Med 2008;359:492–507.[Free Full Text]
  3. Furnari FB, Fenton T, Bachoo RM, et al. Malignant astrocytic glioma: genetics, biology, and paths to treatment. Genes Dev 2007;21:2683–710.[Abstract/Free Full Text]
  4. Louis DN, Ohgaki H, Wiestler OD, Cavenee WK. World Health Organization classification of tumours of the nervous system. 4th ed. Lyon: IARC; 2007.
  5. Ohgaki H, Kleihues P. Genetic pathways to primary and secondary glioblastoma. Am J Pathol 2007;170:1445–53.[Abstract/Free Full Text]
  6. Nakada M, Nakada S, Demuth T, Tran NL, Hoelzinger DB, Berens ME. Molecular targets of glioma invasion. Cell Mol Life Sci 2007;64:458–78.[CrossRef][Medline]
  7. Sathornsumetee S, Rich JN. Designer therapies for glioblastoma multiforme. Ann N Y Acad Sci 2008;1142:108–32.[Medline]
  8. Burgoyne AM, Palomo JM, Phillips-Mason PJ, et al. PTPµ suppresses glioma cell migration and dispersal. Neuro-oncol 2009. Epub ahead of print, March 20, 2009.
  9. Gebbink MF, Zondag GC, Wubbolts RW, Beijersbergen RL, van Etten I, Moolenaar WH. Cell-cell adhesion mediated by a receptor-like protein tyrosine phosphatase. J Biol Chem 1993;268:16101–4.[Abstract/Free Full Text]
  10. Brady-Kalnay SM, Flint AJ, Tonks NK. Homophilic binding of PTPµ, a receptor-type protein tyrosine phosphatase, can mediate cell-cell aggregation. J Cell Biol 1993;122:961–72.[Abstract/Free Full Text]
  11. Brady-Kalnay SM, Tonks NK. Identification of the homophilic binding site of the receptor protein tyrosine phosphatase PTPµ. J Biol Chem 1994;269:28472–7.[Abstract/Free Full Text]
  12. Ensslen-Craig SE, Brady-Kalnay SM. Receptor protein tyrosine phosphatases regulate neural development and axon guidance. Dev Biol 2004;275:12–22.[CrossRef][Medline]
  13. Sallee JL, Wittchen ES, Burridge K. Regulation of cell adhesion by protein-tyrosine phosphatases. II. Cell-cell adhesion. J Biol Chem 2006;281:16189–92.[Abstract/Free Full Text]
  14. Tonks NK. Protein tyrosine phosphatases: from genes, to function, to disease. Nat Rev Mol Cell Biol 2006;7:833–46.[CrossRef][Medline]
  15. Ostman A, Hellberg C, Bohmer FD. Protein-tyrosine phosphatases and cancer. Nat Rev Cancer 2006;6:307–20.[CrossRef][Medline]
  16. Aricescu AR, Siebold C, Jones EY. Receptor protein tyrosine phosphatase µ: measuring where to stick. Biochem Soc Trans 2008;36:167–72.[CrossRef][Medline]
  17. Alonso A, Sasin J, Bottini N, et al. Protein tyrosine phosphatases in the human genome. Cell 2004;117:699–711.[CrossRef][Medline]
  18. Tiganis T, Bennett AM. Protein tyrosine phosphatase function: the substrate perspective. Biochem J 2007;402:1–15.[CrossRef][Medline]
  19. Xie Y, Massa SM, Ensslen-Craig SE, et al. Protein-tyrosine phosphatase (PTP) wedge domain peptides: a novel approach for inhibition of PTP function and augmentation of protein-tyrosine kinase function. J Biol Chem 2006;281:16482–92.[Abstract/Free Full Text]
  20. Oblander SA, Ensslen-Craig SE, Longo FM, Brady-Kalnay SM. E-cadherin promotes retinal ganglion cell neurite outgrowth in a protein tyrosine phosphatase-µ-dependent manner. Mol Cell Neurosci 2007;34:481–92.[CrossRef][Medline]
  21. Campan M, Yoshizumi M, Seidah NG, Lee ME, Bianchi C, Haber E. Increased proteolytic processing of protein tyrosine phosphatase µ in confluent vascular endothelial cells: the role of PC5, a member of the subtilisin family. Biochemistry 1996;35:3797–802.[CrossRef][Medline]
  22. Gebbink MF, Zondag GC, Koningstein GM, Feiken E, Wubbolts RW, Moolenaar WH. Cell surface expression of receptor protein tyrosine phosphatase RPTPµ is regulated by cell-cell contact. J Cell Biol 1995;131:251–60.[Abstract/Free Full Text]
  23. Anders L, Mertins P, Lammich S, et al. Furin-, ADAM 10-, and {gamma}-secretase-mediated cleavage of a receptor tyrosine phosphatase and regulation of β-catenin's transcriptional activity. Mol Cell Biol 2006;26:3917–34.[Abstract/Free Full Text]
  24. Phillips-Mason PJ, Mourton T, Major DL, Brady-Kalnay SM. BCCIP associates with the receptor protein tyrosine phosphatase PTPµ. J Cell Biochem 2008;105:1059–72.[CrossRef][Medline]
  25. Tyminski E, Leroy S, Terada K, et al. Brain tumor oncolysis with replication-conditional herpes simplex virus type 1 expressing the prodrug-activating genes, CYP2B1 and secreted human intestinal carboxylesterase, in combination with cyclophosphamide and irinotecan. Cancer Res 2005;65:6850–7.[Abstract/Free Full Text]
  26. Gebbink MF, van Etten I, Hateboer G, et al. Cloning, expression and chromosomal localization of a new putative receptor-like protein tyrosine phosphatase. FEBS Lett 1991;290:123–30.[CrossRef][Medline]
  27. Hellberg CB, Burden-Gulley SM, Pietz GE, Brady-Kalnay SM. Expression of the receptor protein-tyrosine phosphatase, PTPµ, restores E-cadherin-dependent adhesion in human prostate carcinoma cells. J Biol Chem 2002;277:11165–73.[Abstract/Free Full Text]
  28. Brady-Kalnay SM, Tonks NK. Purification and characterization of the human protein tyrosine phosphatase, PTPµ, from a baculovirus expression system. Mol Cell Biochem 1993;127–8:131–41.
  29. Franken NA, Rodermond HM, Stap J, Haveman J, van Bree C. Clonogenic assay of cells in vitro. Nat Protoc 2006;1:2315–9.[CrossRef][Medline]
  30. Yu J, Becka S, Zhang P, Zhang X, Brady-Kalnay SM, Wang Z. Tumor-derived extracellular mutations of PTPRT/PTP{rho} are defective in cell adhesion. Mol Cancer Res 2008;6:1106–13.[Abstract/Free Full Text]
  31. Chow JP, Fujikawa A, Shimizu H, Suzuki R, Noda M. Metalloproteinase- and {gamma}-secretase-mediated cleavage of protein-tyrosine phosphatase receptor type Z. J Biol Chem 2008;283:30879–89.[Abstract/Free Full Text]
  32. Haapasalo A, Kim DY, Carey BW, Turunen MK, Pettingell WH, Kovacs DM. Presenilin/{gamma}-secretase-mediated cleavage regulates association of leukocyte-common antigen-related (LAR) receptor tyrosine phosphatase with β-catenin. J Biol Chem 2007;282:9063–72.[Abstract/Free Full Text]
  33. Rao JS. Molecular mechanisms of glioma invasiveness: the role of proteases. Nat Rev Cancer 2003;3:489–501.[CrossRef][Medline]
  34. Kopan R, Schroeter EH, Weintraub H, Nye JS. Signal transduction by activated mNotch: importance of proteolytic processing and its regulation by the extracellular domain. Proc Natl Acad Sci U S A 1996;93:1683–8.[Abstract/Free Full Text]
  35. Brady-Kalnay SM, Rimm DL, Tonks NK. Receptor protein tyrosine phosphatase PTPµ associates with cadherins and catenins in vivo. J Cell Biol 1995;130:977–86.[Abstract/Free Full Text]
  36. Roy M, Pear WS, Aster JC. The multifaceted role of Notch in cancer. Curr Opin Genet Dev 2007;17:52–9.[CrossRef][Medline]
  37. Shih IeM, Wang TL. Notch signaling, {gamma}-secretase inhibitors, and cancer therapy. Cancer Res 2007;67:1879–82.[Abstract/Free Full Text]
  38. Brady-Kalnay SM, Mourton T, Nixon JP, et al. Dynamic interaction of PTPµ with multiple cadherins in vivo. J Cell Biol 1998;141:287–96.[Abstract/Free Full Text]
  39. Sui XF, Kiser TD, Hyun SW, et al. Receptor protein tyrosine phosphatase µ regulates the paracellular pathway in human lung microvascular endothelia. Am J Pathol 2005;166:1247–58.[Abstract/Free Full Text]
  40. Hiscox S, Jiang WG. Association of PTPµ with catenins in cancer cells: a possible role for E-cadherin. Int J Oncol 1998;13:1077–80.[Medline]
  41. Zondag GC, Reynolds AB, Moolenaar WH. Receptor protein-tyrosine phosphatase RPTPµ binds to and dephosphorylates the catenin p120(ctn). J Biol Chem 2000;275:11264–9.[Abstract/Free Full Text]
  42. van Hengel J, van Roy F. Diverse functions of p120ctn in tumors. Biochim Biophys Acta 2007;1773:78–88.[Medline]
  43. Daniel JM, Reynolds AB. The catenin p120(ctn) interacts with Kaiso, a novel BTB/POZ domain zinc finger transcription factor. Mol Cell Biol 1999;19:3614–23.[Abstract/Free Full Text]
  44. Ferber EC, Kajita M, Wadlow A, et al. A role for the cleaved cytoplasmic domain of E-cadherin in the nucleus. J Biol Chem 2008;283:12691–700.[Abstract/Free Full Text]
  45. Uemura K, Kihara T, Kuzuya A, et al. Characterization of sequential N-cadherin cleavage by ADAM10 and PS1. Neurosci Lett 2006;402:278–83.[CrossRef][Medline]
  46. Kouchi Z, Barthet G, Serban G, Georgakopoulos A, Shioi J, Robakis NK. p120 catenin recruits cadherins to {gamma}-secretase and inhibits production of Aβ peptide. J Biol Chem 2009;284:1954–61.[Abstract/Free Full Text]
  47. Kelly KF, Spring CM, Otchere AA, Daniel JM. NLS-dependent nuclear localization of p120ctn is necessary to relieve Kaiso-mediated transcriptional repression. J Cell Sci 2004;117:2675–86.[Abstract/Free Full Text]
  48. Ono T, Kitaura H, Ugai H, et al. TOK-1, a novel p21Cip1-binding protein that cooperatively enhances p21-dependent inhibitory activity toward CDK2 kinase. J Biol Chem 2000;275:31145–54.[Abstract/Free Full Text]
  49. Audhya A, Emr SD. Regulation of PI4,5P2 synthesis by nuclear-cytoplasmic shuttling of the Mss4 lipid kinase. EMBO J 2003;22:4223–36.[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplementary Data
Right arrow All Versions of this Article:
0008-5472.CAN-09-0863v1
69/17/6960    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Google Scholar
Right arrow Articles by Burgoyne, A. M.
Right arrow Articles by Brady-Kalnay, S. M.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burgoyne, A. M.
Right arrow Articles by Brady-Kalnay, S. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online