Skip to main content
  • AACR Publications
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

  • Register
  • Log in
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Focus on Computer Resources
    • 75th Anniversary
    • Meeting Abstracts
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • OnlineFirst
    • Editors' Picks
    • Citations
    • Author/Keyword
  • News
    • Cancer Discovery News
  • AACR Publications
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in

Search

  • Advanced search
Cancer Research
Cancer Research

Advanced Search

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Focus on Computer Resources
    • 75th Anniversary
    • Meeting Abstracts
  • For Authors
    • Information for Authors
    • Author Services
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • OnlineFirst
    • Editors' Picks
    • Citations
    • Author/Keyword
  • News
    • Cancer Discovery News
Molecular Biology, Pathobiology and Genetics

Targeted Expression of Human MYCN Selectively Causes Pancreatic Neuroendocrine Tumors in Transgenic Zebrafish

Hong Wei Yang, Jeffery L. Kutok, Nam Hyuk Lee, Hui Ying Piao, Christopher D. M. Fletcher, John P. Kanki and A. Thomas Look
Hong Wei Yang
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jeffery L. Kutok
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Nam Hyuk Lee
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Hui Ying Piao
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Christopher D. M. Fletcher
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
John P. Kanki
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
A. Thomas Look
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1158/0008-5472.CAN-04-0931 Published October 2004
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Abstract

The zebrafish model organism has been used extensively for studies of genetic pathways in development, indicating its potential applicability to cancer. Here we show that targeted expression of MYCN in cells of the pancreatic islet induces neuroendocrine carcinoma. Four transgenic fish developed abdominal tumors between 4 and 6 months of age, and histologic analysis revealed lobulated arrangements of neoplastic cells with expression of the MYCN transgene. The tumors also expressed insulin mRNA, and pancreatic exocrine cells and ducts were identified within the neoplasms, indicating a pancreatic origin for the tumor. Transmission electron microscopy revealed cytoplasmic, endocrine-dense core granules, analogous to those found in human neuroendocrine tumors. Our studies establish a zebrafish transgenic model of pancreatic neuroendocrine carcinoma, setting the stage to evaluate molecular pathways downstream of MYCN in this vertebrate forward genetic model system.

INTRODUCTION

The zebrafish system has been broadly used for elucidating genetic pathways in development (1, 2, 3, 4) . The zebrafish has also been shown to be a relevant vertebrate system to model human cancer, displaying many similarities in tumorigenic pathways, despite the evolutionary divergence of mammals and fish more than 300 million years ago (5 , 6) . The zebrafish (whose genome contains cell-cycle genes, tumor suppressor genes, and oncogenes found in humans and other mammals) has enormous potential as a vertebrate system in which to identify novel molecular pathways of oncogenesis, especially because zebrafish are prone to develop tumors (5 , 7, 8, 9, 10, 11) . Zebrafish have also played an important role as a vertebrate model system in carcinogenesis to determine environmental effects, genetic susceptibility, and environmental-genomic interactions (5 , 12, 13, 14) .

Recently, our laboratory has developed the first transgenic model of leukemia in the zebrafish, by expressing the murine Myc gene in developing thymocytes, under the control of the Rag-2 promoter (6) . Given the proven utility of the zebrafish system for forward genetic screens to dissect developmental pathways (1, 2, 3, 4) , it should be possible to find modifier genes that either accelerate or reduce the rate of onset of leukemia in these transgenic lines. The zebrafish system is also conducive to high-throughput target validation and drug screening, providing a crucial link between high-throughput in vitro assays and in vivo disease models (15) .

MYC, MYCN, and MYCL are the three members of the Myc oncoprotein family with well-established roles in the pathogenesis of many human neoplastic diseases (16) . MYCN, for example, is amplified and misexpressed in a variety of different tumors including ∼25% of childhood neuroblastomas, where it signifies an adverse prognosis (17 , 18) , as well as in tumors of neuroectodermal origin, including medulloblastoma, retinoblastoma, astrocytoma, glioblastoma, rhabdomyosarcoma, and small-cell lung cancer (19, 20, 21, 22, 23) .

In this study, we generated transgenic zebrafish by targeted expression of the human MYCN transgene under the control of a promoter that targets gene expression in pancreatic neuroendocrine β cells as well as in muscle cells and neurons. These transgenic fish selectively developed pancreatic β-cell tumors that express insulin mRNA and histologically resemble human pancreatic neuroendocrine carcinomas.

MATERIALS AND METHODS

Cloning of Zebrafish myod Gene (z-myod) Genomic DNA, Construction of Plasmids, and Microinjection of DNA into Zebrafish Embryos.

A z-myod genomic PAC clone was isolated by screening a zebrafish PAC library with a z-myod cDNA probe. A 6-kb promoter fragment was then isolated from the z-myod PAC with ApaI and EcoR V and cloned into a pSK+ vector. The z-myod–EGFP construct was made by inserting the EGFP in frame with the ATG codon of the z-myod gene. The 258-bp core enhancer of the human MYOD gene (24) was cloned by PCR and then inserted at the 5′ end of the z-myod promoter construct (zmyod-EGFP; Fig. 1A ⇓ ) to make the core-zmyod–EGFP construct (Fig. 2A) ⇓ . The z-myod–MYCN and core-zmyod–MYCN constructs were generated by replacing the EGFP with the MYCN cDNA in the zmyod-EGFP and core-zmyod–EGFP constructs. The DNA for injection was released from vector by PvuI digestion and then purified from the gel with a QIAEX II Gel Purification Kit (Qiagen Inc., Valencia, CA). The F0 mosaic fish were generated by injecting the linearized transgenes (100 ng/μL) into the cytoplasm of fertilized embryos at the one-cell stage.

Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1.

EGFP expression in the z-myod–EGFP transgenic line. A. The zmyod-EGFP transgenic construct was made by fusing the EGFP coding sequence to a 6-kb promoter fragment of the z-myod gene. Zebrafish embryos microinjected at the one-cell stage began expressing EGFP as early as 6 hpf (data not shown). B. At 30 hpf, EGFP is expressed in the hindbrain (arrowhead) and notochord (arrow). C. At 48 hpf, EGFP is strongly expressed in the hindbrain (arrowhead), notochord (arrow), and neurons in the spinal cord (open arrowhead). D and E. EGFP is expressed in pancreatic islet cells (arrow) at 5 days post-fertilization (dpf), as shown in dorsolateral and dorsal views, respectively. Expression in the hindbrain and developing pectoral fins is indicated (open arrowhead). F–H, sagittal frozen section through the pancreatic islet of 5 dpf zebrafish (400×). F, bright field. G, EGFP fluorescence. H, merged view [exocrine cells (e) and islet cells (i) are indicated]. I–K, paraffin-embedded section through the pancreatic islet of the adult zebrafish. I, H&E stain. J, mRNA in situ hybridization with an insulin antisense riboprobe. K, immunohistochemical staining with an anti-GFP antibody (dark brown cells, arrows; Pancreatic islet cells (arrows) and exocrine cells (e) are indicated). (hb, hindbrain)

Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2.

Gene expression patterns in the core-zmyod–EGFP transgenic line. A. The transgenic construct was made by fusing the human MYOD 258-bp upstream core enhancer to the 5′ end of the zmyod-EGFP construct (Fig. 1A ⇓ ). B. Lateral views at 30 hpf, showing EGFP expression (green cells) in the spinal cord (arrowhead) and somites (arrow). B–I, anterior is to the left. C, endogenous z-myod expression detected in somitic muscle cells by mRNA in situ hybridization (arrow). D and E, dorsal views of the zebrafish in panels B and C, respectively. F, ventral view of the head at 5 dpf, showing high levels of expression of EGFP in the jaw muscles. G, ventral view at 5 dpf, showing endogenous z-myod expression, by mRNA in situ hybridization. H, schematic diagram showing the jaw muscles evident in F and G. I, lateral view of EGFP expression in the head and upper abdomen of a 5 dpf zebrafish (arrow, pancreatic islet). J–L, frozen cross section through the pancreas at 5 dpf. J, bright-field view (e, exocrine cells; i, islet are indicated; R, right side). K, EGFP fluorescence (superficial slow muscle, arrow); and L, merged view of sections cut along the plane shown by the dashed lines in panel I. M–O, colocalization of insulin and EGFP in islet cells. M, immunofluorescence of insulin in an islet cell (red cells). N, EGFP fluorescence. O, merged view, arrows indicate a cell expressing insulin and EGFP. P–R, colocalization of glucagon and EGFP in islet cells. P, immunofluorescence analysis of glucagons expression (red cells). Q, EGFP fluorescence. R, merged view: arrows indicate a cell expressing glucagon and EGFP. (ima, intermantibularis anterior; imp, intermantibularis posterior; am, adductor mandibulae; hh, hypohyroideus; sh, sternalhyoideus)

Fish Maintenance and Embryonic Staging.

Zebrafish were maintained and developmentally staged according to Westerfield et al. (25) . Briefly, wild-type fish were mated, and the embryos were collected and grown in E3 medium (5 mmol/L NaCl, 0.17 mmol/L KCl, 0.4 mmol/L CaCl2, and 0.16 mmol/L MgSO4) at 28.5°C. Between 18 and 24 hours post-fertilization (hpf), embryos were transferred to E3 medium containing 0.003% 1-phenyl-2-thiourea to inhibit pigment formation and to prolong their optical transparency. Embryos were fixed at various stages of development in 4% paraformaldehyde at 4°C overnight. Fixed embryos were washed in PBS with 0.1% Tween 20 and stored in methanol at −20°C.

Whole-Mount In situ Hybridization.

Digoxigenin- and fluorescein-labeled RNA probes were transcribed from linear cDNA constructs according to the manufacturer’s instructions (Roche Molecular Biochemicals, Indianapolis, IN). Probes for zebrafish insulin, glucagon, and somatostatin were kindly provided by Dr. F. Argenton (Department of Biology, University of Padova, Padova, Italy). Probes were isolated by reverse transcription-PCR with primers based on the sequences in the National Center for Biotechnology Information database for chromogranin A (BM025152; primers: forward, 5′AACACCAGCAGCGCCTAATG; and reverse, 5′AGTCTTTAGGGAGGCTGGTC) and synaptophysin (BM958377; primers: forward, 5′CCGGAATCGAAGTGTTTTGT; and reverse, 5′GCTGGTAGCCCAAGTACAGG). Whole-mount in situ hybridization assays were done as described previously (26) .

Paraffin Embedding and Sectioning.

Euthanized fish were placed in 4% paraformaldehyde at 4°C for 4 days and then transferred to 0.25 mol/L EDTA (pH 8.0) for no less than 2 days. The fish were then dehydrated in alcohol, cleared in xylene, and infiltrated with paraffin. Tissue sections (4-μm thick) from paraffin-embedded tissue blocks were placed on charged slides, deparaffinized in xylene, rehydrated through graded alcohol solutions, and stained with hematoxylin/eosin (H&E).

Immunohistochemistry.

Immunohistochemical studies for green fluorescent protein (GFP) were done as described previously (6) . Immunofluorescence for insulin was done on 10-μm frozen sections with anti-insulin K36aC10 (1:1,000; Sigma, St. Louis, MO), antiglucagon (1:100; Chemicon, Temecula, CA), and Cy3-conjugated antimouse IgG was used as secondary antibody. Confocal images were taken on a Zesiss LSM 510 microscope.

Electron Microscopy.

Tumor tissue was fixed in a glutaraldehyde/paraformaldehyde mixture (2.5% glutaraldehyde; 2% paraformaldehyde) in 0.1 mol/L sodium cacodylate buffer (pH 7.4). After a brief rinse in 5% sucrose in 0.1 mol/L sodium cacodylate buffer (pH 7.4), tissues were post-fixed in osmium-S-collidine solution [1.33% osmium tetroxide in 0.066 mol/L S-collidine buffer (pH 7.4)] for 2 hours. The tissue was then dehydrated in graded EtOH solutions, cleared in propylene oxide, and infiltrated first in a 1:1 mixture of propylene oxide and Poly/Bed mixture for 60 minutes, followed by infiltration in undiluted Poly/Bed for 30 minutes. Semithin sections (1.0 μm) were stained with alkaline toluidine blue, and ultrathin sections were cut on an ultramicrotome, picked up on 200 mesh copper grids, and stained on the grid with saturated uranyl acetate solution for 15 minutes and 0.1 to 0.4% of lead citrate for 45 seconds. The grids were examined in a Jeol JEM 1010 electron microscope at 80 kV acceleration voltage. Images were recorded with an AMT digital camera.

RESULTS

Analysis of Zebrafish z-myod Promoter Sequences In vivo.

In hopes of generating transgenic lines that express transgenes in muscle cell progenitors, we cloned 6.0 kb of genomic sequence upstream of the initiator codon of z-myod and fused these sequences to the gene encoding enhanced green fluorescence protein (EGFP; Fig. 1A ⇓ ). This transgene was microinjected into the cytoplasm of fifty fertilized zebrafish embryos (one-cell stage) to generate F0 mosaic fish. The F1 progeny of one of these fish expressed EGFP during embryogenesis, indicating germline transmission of the transgene. In this stable line, EGFP was expressed primarily in the interneurons of the hindbrain and spinal cord and lacked expression in the skeletal musculature (Fig. 1, B–E) ⇓ , indicating that the genomic sequences tested had promoter activity but lacked sequences required for expression in developing muscle cells. EGFP was also ectopically expressed in islet cells of the pancreas (Fig. 1, D–K) ⇓ .

Similar results have been obtained in the mouse, in that a minimal mouse MyoD promoter ectopically drives transgene expression in the brain and spinal cord. In the mouse, a 258-bp core enhancer, located 20 kb upstream of the initiator codon, was identified that is required for expression in muscle cells (24 , 27 , 28) . Rather than search for an analogous element in the zebrafish gene, we cloned the human MYOD 258-bp core enhancer upstream of the 6.0-kb zebrafish promoter sequence generating a construct, core-zmyod–EGFP (Fig. 2A) ⇓ . Eighty zebrafish embryos were injected with this construct, grown to adulthood, and the offspring of two of these fish were found to express EGFP, indicating germline transmission of the transgene. These lines showed EGFP expression in the muscle cells of the somites at 24 hpf and in the jaw muscles beginning at 72 hpf. The pattern of transgene expression in muscle cells with this construct was nearly identical to the pattern of expression of the endogenous z-myod gene, as detected by whole-mount in situ hybridization assay with an antisense z-myod riboprobe (Fig. 2, B–H) ⇓ . However, expression levels of the transgene in the hindbrain, spinal cord, and pancreatic islet were similar to those previously obtained with the 6.0-kb zebrafish genomic fragment, indicating that although the human MyoD core enhancer sequences were able to activate transgene expression by muscle cells, the ectopic expression in neural cells, and the pancreas was not suppressed. (Fig. 2, D and I–L) ⇓ . Although EGFP expression is most prominent in the exocrine pancreas, expression was also evident in a subset of the endocrine cells (Fig. 2, K and L) ⇓ . To specifically document EGFP expression by pancreatic endocrine cells in this line, we showed that the core z-myod promoter construct (EGFP; green) is coexpressed with insulin (Cy3; red) in a subset of pancreatic endocrine cells (Fig. 2, M–O) ⇓ , and with glucagon (Cy3; red), also in a subset of these cells (Fig. 2, P–R) ⇓ .

Neuroendocrine Tumors in MYCN Transgenic Zebrafish.

To generate MYCN transgenic fish, we fused the human MYCN oncogene to either the z-myod or core-zmyod promoter sequences. The linearized transgenic constructs were microinjected into the cytoplasm of one-cell stage embryos to generate 250 F0 mosaic fish. Five of these mosaic transgenic fish developed tumors between 3 and 6 months of age. In two cases, MYCN was driven by the z-myod promoter and in three cases, MYCN was driven by the core-zmyod promoter (Table 1) ⇓ . One of the fish (Case 3) was sacrificed when it developed exopthalmos at three months of age, and histologic analysis of tissues underlying the eye indicated an epithelial tumor with neuroendocrine differentiation (Fig. 3) ⇓ . The tumor cells expressed the MYCN transgene, as indicated by in situ hybridization assay with an antisense MYCN riboprobe (Fig. 3I) ⇓ .

Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3.

Pathological analysis of an intracranial tumor arising in MYCN transgenic fish (Case 3, Table 1 ⇓ ). A and B, gross morphology of adult zebrafish. A, wild-type control. B, core-zmyod–MYCN transgenic fish showing massive exopthlamos. C–G, H&E staining of paraffin cross sections. C, wild-type. D. Core-zmyod–MYCN transgenic fish, showing tumor cells effacing the retro-orbital space, leaving a clear boundary between tumor cells and surrounding tissues (20× magnification). E. Cross section through the hindbrain reveals the tumor was originating within the cranial cavity. F, magnified view of tumor cells (400× magnification). G, section through the pancreas (arrow) showing normal tissue morphology. H, mRNA in situ hybridization with a sense, control RNA probe. I, mRNA in situ hybridization with an antisense RNA probe for the human MYCN gene, reveals high levels of MYCN expression (dark staining).

View this table:
  • View inline
  • View popup
Table 1

Characteristics of tumors in MYCN mosaic transgenic zebrafish

The remaining four transgenic fish developed abdominal tumors between 4 and 6 months of age (Fig. 4, A–D) ⇓ . The tumors were anatomically distinct from the liver, and histologic analysis of paraffin sections revealed an encapsulated, lobulated, or nested arrangement of neoplastic-appearing cells. These cells were polygonal in shape and possessed a high nuclear/cytoplasmic ratio, distinct nucleoli and small to moderate amounts of eosinophilic cytoplasm. Delicate fibrovascular stromal tissue gave some tumors a clearly nested or nodular appearance. The mitotic rate was low, and single cell necrosis was minimal; however, the expansile tumors were locally invasive into adjacent nonpancreatic tissue (Fig. 4H) ⇓ . Small residual aggregates of normal-appearing pancreatic exocrine cells and ducts were identified within the neoplasm, which together with the histologic features, suggested a pancreatic origin for the tumor (Fig. 4, E–G) ⇓ . To aid in confirming this histologic evaluation, transmission electron microscopy was done on tissues from two tumors. In one of the two tumors, well-granulated tumor cells were identified with solid, round to slightly irregular haloed cytoplasmic neurosecretory granules of low to intermediate density, suggestive of those seen in human neuroendocrine tumors (Fig. 4I) ⇓ . In addition, intermembrane tight junctions of epithelial cells were evident (Fig. 4J) ⇓ .

Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4.

Histologic analysis of human MYCN-induced pancreatic tumors in zebrafish. A–D, 20× magnification of H&E-stained paraffin sections of adult zebrafish. A and B, cross section. C and D, sagittal section. A and C, wild-type. B and D, two different transgenic fish. E. The 400× magnification of B, pancreatic duct (bold arrow), and pancreatic cells (small pink cells, arrow) were identified within the tumor tissue. F, 400× magnification of D, normal pancreatic cells (small pink cells, arrows). G–H, histology of tumors in core-zmyod–MYCN transgenic fish (400× original magnification). G. Pancreatic cells (arrow) are distributed through the tumor tissue. H, Expansile tumors were locally invasive into adjacent nonpancreatic tissue and musculature (arrows). I, electron microscopic image of tumor tissue shown in G, arrows indicate the secretory granules in the cytoplasm of the tumor cells. J. Electron microscopic image of tumor tissue shown in H; the tumor showed some characteristics of epithelial cells, the arrow indicates the intermembranous tight junctions between two tumor cells. (g, gut; l, liver; p, pancreas; sb, swim bladder; T, tumor)

To additionally establish the endocrine nature of these tumors, in situ hybridization assays were done with mRNA probes encoding hormones, the expression levels of which are used as markers for neuroendocrine tumors (29) . Synaptophysin is an integral membrane protein of small synaptic vesicles in brain and endocrine cells (30) . Insulin is synthesized by the β cells of pancreatic islets (31) . Glucagon is a 29-amino acid pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis (32) . Chromogranin A is secreted by a great variety of peptide-producing endocrine neoplasms: pheochromocytoma, parathyroid adenoma, medullary thyroid carcinoma, carcinoids, oat-cell lung cancer, pancreatic islet-cell tumors, and aortic-body tumor (33) . Somatostatin is widely distributed throughout the body and is an important regulator of endocrine and nervous system function (34) . The tumor cells of Case 3 expressed zebrafish synaptophysin (z-syn) RNA but not zebrafish insulin (z-ins), glucagon (z-glu), chromogranin (z-chr), or somatostatin (z-soma; Table 1 ⇓ ; data not shown). The tumor cells of Cases 1, 2, 4, and 5 all expressed both high levels of human MYCN mRNA (Fig. 5, A and B) ⇓ as well as zebrafish insulin mRNA (Fig. 5, C–F) ⇓ . One fish (Table 1 ⇓ , Case 4) also revealed slightly positive staining of glucagon (z-glu; data not shown). We did not detect expression of zebrafish chromogranin (z-chr) or somatostatin (z-soma; Table 1 ⇓ ; data not shown). Taken together, our studies indicate that the z-myod promoter-driving MYCN expression in the zebrafish causes the development of neuroendocrine epithelial tumors that are classified as neuroendocrine carcinomas, with anatomic and gene expression findings in four of the five tumors, suggesting origins in insulin-producing islet cells of the pancreas.

Fig. 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 5.

The mRNA in situ hybridization analysis of human MYCN-induced pancreatic tumors in transgenic zebrafish (400× original magnification). A and B, MYCN mRNA in situ hybridization. A, mRNA in situ hybridization with a sense, control RNA. B, mRNA in situ hybridization with an antisense RNA probe for the human MYCN gene, revealed high levels of tumor-cell–specific expression of the MYCN transgene. C–F, insulin mRNA in situ hybridization analysis. C and E, mRNA in situ hybridization with sense control RNA probe. D and F, mRNA in situ hybridization with an antisense RNA probe for the zebrafish insulin gene, revealed high levels of expression of the gene by the tumor cells.

At one year of age, all of the F0 MYCN transgene-injected fish were sacrificed, and serial transverse sections were stained with H&E and analyzed histologically for the presence of tumors. We did not detect any additional neuroendocrine tumors or any other type of tumor in this analysis, indicating that although the zmyod promoters drive transgene expression in other organs, the misexpression of MYCN does not initiate cancer in other tissue types. It is possible that in tissues other than the endocrine pancreas, the zmyod promoters drive the expression of MYCN in cells that have differentiated further, which lack self-renewal capacity and thus cannot form malignant tumors.

DISCUSSION

We have developed a zebrafish transgenic model system for pancreatic neuroendocrine carcinoma. In humans, pancreatic neuroendocrine tumors include both benign and malignant epithelial neoplasms that show evidence of endocrine cell differentiation (35) . These tumors often secrete active hormones, such as insulin or glucagon, and patients may suffer from pronounced paraneoplastic syndromes because of the overproduction of these hormones. Insulin-secreting β-islet cell tumors are the most common type of pancreatic neuroendocrine neoplasms in man. The locally invasive growth pattern identified in our zebrafish tumors favors a malignant rather than a benign lesion.

Relatively little is known about the genetic events that occur during the initiation and progression of pancreatic β-cell neoplasms in humans. However, several observations suggest that activation of the proto-oncogenes, MYC and RAS and overexpression of transforming growth factor α (TGF-α) often occur with malignant progression and that mutations inactivating the p53 tumor suppressor protein are common (36 , 37) . Pavelic et al. (36 , 37) have proposed that MYC activation appears to be an early event in human β-cell tumor progression, because it is expressed at higher levels in β-cell hyperplastic islets than in normal islet cells and at even higher levels in benign and malignant tumors.

We used an upstream fragment of the zebrafish z-myod gene as the promoter to generate transgenic animal expressing the human MYCN oncogene. Mammalian MyoD promoters have a very complicated structure. A 258-bp enhancer located 20 kb upstream of the transcriptional start site is necessary to drive transgene expression in muscle cell progenitors in the mouse, because a minimal promoter fragment, lacking this upstream motif, primarily mediates neuronal expression (24 , 27 , 28) . Our results in zebrafish were quite similar, in that a 6-kb minimal promoter fragment of z-myod resulted in EGFP expression that was most pronounced in the hindbrain, spinal cord, and pancreatic islets (Fig. 1, A and B) ⇓ . These results suggest that the 6-kb promoter of z-myod has activity but lacks the elements necessary to initiate muscle expression, as had been previously observed for the mouse minimal promoter of MyoD in transgenic mice (24 , 27) . In an attempt to obtain expression in zebrafish muscle cells, we tested the 258-bp core enhancer of the human MYOD gene upstream of our z-myod promoter fragment, forming a human-zebrafish chimeric promoter. Interestingly, this chimeric promoter functioned well to drive high levels of transgene expression in muscle cells of the zebrafish, both when transiently injected at the one-cell stage and also in the progeny of two different EGFP-expressing stable lines. Muscle cells in both the trunk and the craniofacial regions expressed high levels of EGFP. However, the 258-bp core enhancer of the human MYOD gene did not prevent the ectopic expression of EGFP in neuronal and pancreatic islet cells in our transgenic lines, suggesting that our chimeric construct still lacks repressor sequence motifs that commonly prevent expression of the endogenous z-myod gene in these tissues. Our success in using human enhancer elements to drive muscle expression in zebrafish suggests evolutionary conservation of regulatory enhancer sequence elements and trans-acting transcription factors between these two species and raises the possibility that the zebrafish system could be used to help identify and analyze the sequence motifs and transacting factors, the homologues of which perform similar roles during mammalian development.

The c-Myc proto-oncogene is implicated in pancreatic β-cell proliferation in tumorigenesis and may contribute to apoptosis of the same cells in diabetes (38) . Although the vast majority of functional and transgenic studies of islet cell tumors have focused on the c-Myc protein, N-Myc functions in a very similar manner in a number of cell culture assays (39 , 40) . Indeed, when the coding region of the mouse c-Myc gene was replaced with the N-Myc coding sequence by homologous recombination, the resulting homozygous knock-in mice, in which the c-Myc promoter drives the synthesis of N-Myc mRNA instead of c-Myc mRNA, were viable and appeared normal, indicating that the N-Myc protein can functionally replace c-Myc if it is appropriately regulated (41) . β-cell tumors that express insulin mRNA and histologically resemble human pancreatic endocrine carcinomas have been produced by transgenic expression of c-Myc, indicating the importance of the Myc pathway in the molecular pathogenesis of pancreatic neuroendocrine carcinoma (42) . Studies in transgenic mice have shown that Myc activation initially promotes both proliferation and apoptosis in pancreatic β cells and that tumors arise when the apoptosis pathway is suppressed, indicating the need for at least two mutational events before tumors arise (42) . Studies with a conditional c-Myc allele also showed that Myc expression is required not only for initiation for the tumor but also to maintain the neoplastic phenotype of established tumors (42) . More recently, Lewis et al. (43) have generated a mouse model for pancreatic cancer through the somatic delivery of oncogene-bearing avian retroviruses to mice that express TVA, the receptor for avian leukosis sarcoma virus subgroup A (ALSV-A), under the control of the elastase promoter. Infection of elastase-tv-a transgenic mice, either wild-type or null for the Ink4a/Arf locus, with viruses encoding mouse polyoma virus middle T antigen induced highly penetrant acinar and ductal tumors. In contrast, infection of elastase-tv-a, Ink4a/Arf null mice with viruses encoding the c-Myc oncoprotein led to the formation of pancreatic endocrine tumors exclusively, indicating the importance of Myc in the tumorigenesis of pancreatic endocrine tumors (43) .

We were surprised that we did not recover rhabdomyosarcoma in transgenic fish expressing MYCN driven by the core-zmyod promoter, because we observed high levels of expression of GFP in embryonic muscle cells with this promoter, and MYCN is amplified and overexpressed in most human rhabdomyosarcomas (44) . There are several possibilities to explain this observation. Although expressed at high levels in muscle cells, core-zmyod may not drive expression in muscle stem cells with the capacity for self-renewal, thus preventing the acquisition of additional mutations needed for the formation of a malignant tumor. Alternatively, high levels of MYCN expression driven by this promoter may lead to apoptosis of muscle stem cells that integrate the transgene, preventing transformation. Lastly, it remains possible that MYCN overexpression is not a rate-limiting step in rhabdomyosarcoma and that other mutations are needed before developing myoblasts are susceptible to MYCN-induced transformation.

One advantage of the zebrafish model lies in its ability to accommodate large-scale “forward-genetic” screens to identify modifier genes. For such screens we will need to establish a stable transgenic line expressing MYCN, which we have not thus far recovered, although we were able to generate stable lines expressing EGFP alone from both promoters. A likely possibility is that the promoter we are using drives MYCN expression in germ cells that integrate the transgene, which is toxic to them. We are now injecting a Cre-Lox conditional transgene to establish stable lines that only express EGFP until MYCN is induced through the controlled expression of Cre. This system has worked with other promoters, so we feel confident that it will ultimately be successful.

Once forward-genetic screens become possible in our system, germline mutations induced by either ethyl-nitrosourea or retroviral integration into large numbers of mutagenized transgenic zebrafish will be analyzed for mutations that accelerate or retard the rate of development of Myc-induced tumors. For example, mutations that inactivate tumor suppressor genes and accelerate the onset of clonal tumors should be identified, because the mutant fish would carry inactivating mutations of single tumor suppressor alleles throughout development, increasing the likelihood of acquiring inactivating mutations or deletions affecting both alleles of the same gene. In addition, mutations identified in unbiased screens that delay or prevent tumorigenesis may provide insight into human homologues that could serve as targets for the development of small molecule inhibitors.

Acknowledgments

We thank Janice Williams, Vuong Nguyen, and Coneen Ford for expert technical assistance, Doris Dodson for manuscript preparation, and George Kourkoulis, Jessica Vinokur, and Walt Saganic for excellent zebrafish care and maintenance. We also thank Dr. Argenton, who kindly provided us with the probes for zebrafish insulin, glucagon, and somatostatin.

Footnotes

  • Grant support: Claudia Adams Barr Awards for Innovative Cancer Research (H. Yang and A. Look) and NIH Grant NIH-P30CA6516.

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • Requests for reprints: A. Thomas Look, Department of Pediatric Oncology, Mayer 630, Dana-Farber Cancer Institute, Boston, MA 02115. Phone: (617) 632-5826; E-mail: thomas_look{at}dfci.harvard.edu

  • Received March 22, 2004.
  • Revision received August 24, 2004.
  • Accepted August 26, 2004.
  • ©2004 American Association for Cancer Research.

References

  1. ↵
    Driever W, Solnica-Krezel L, Schier AF, et al A genetic screen for mutations affecting embryogenesis in zebrafish. Development (Camb) 1996; 123: 37-46.
    OpenUrlAbstract/FREE Full Text
  2. ↵
    Haffter P, Granato M, Brand M, et al The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development (Camb) 1996; 123: 1-36.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    Peterson RT, Link BA, Dowling JE, Schreiber SL Small molecule developmental screens reveal the logic and timing of vertebrate development. Proc Natl Acad Sci USA 2000; 97: 12965-9.
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Peterson RT, Mably JD, Chen JN, Fishman MC Convergence of distinct pathways to heart patterning revealed by the small molecule concentramide and the mutation heart-and-soul. Curr Biol 2001; 11: 1481-91.
    OpenUrlCrossRefPubMed
  5. ↵
    Amatruda JF, Shepard JL, Stern HM, Zon LI Zebrafish as a cancer model system. Cancer Cell 2002; 1: 229-31.
    OpenUrlCrossRefPubMed
  6. ↵
    Langenau DM, Traver D, Ferrando AA, et al Myc-induced T cell leukemia in transgenic zebrafish. Science (Wash DC) 2003; 299: 887-90.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Inohara N, Nunez G Genes with homology to mammalian apoptosis regulators identified in zebrafish. Cell Death Differ 2000; 7: 509-10.
    OpenUrlCrossRefPubMed
  8. ↵
    Langenau DM, Palomero T, Kanki JP, et al Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio). Mech Dev 2002; 117: 243-8.
    OpenUrlCrossRefPubMed
  9. ↵
    Liu TX, Zhou Y, Kanki JP, et al Evolutionary conservation of zebrafish linkage group 14 with frequently deleted regions of human chromosome 5 in myeloid malignancies. Proc Natl Acad Sci USA 2002; 99: 6136-41.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Kalev-Zylinska ML, Horsfield JA, Flores MV, et al Runx1 is required for zebrafish blood and vessel development and expression of a human RUNX1-CBF2T1 transgene advances a model for studies of leukemogenesis. Development (Camb) 2002; 129: 2015-30.
  11. ↵
    Smolowitz R, Hanley J, Richmond H A three-year retrospective study of abdominal tumors in zebrafish maintained in an aquatic laboratory animal facility. Biol Bull 2002; 203: 265-6.
    OpenUrlFREE Full Text
  12. ↵
    Walker WW, Manning CS, Overstreet RM, Hawkins WE Development of aquarium fish models for environmental carcinogenesis: an intermittent-flow exposure system for volatile, hydrophobic chemicals. J Appl Toxicol 1985; 5: 255-60.
    OpenUrlCrossRefPubMed
  13. ↵
    Spitsbergen JM, Tsai HW, Reddy A, et al Neoplasia in zebrafish (Danio rerio) treated with N-methyl-N′-nitro-N-nitrosoguanidine by three exposure routes at different developmental stages. Toxicol Pathol 2000; 28: 716-25.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Spitsbergen JM, Tsai HW, Reddy A, et al Neoplasia in zebrafish (Danio rerio) treated with 7,12-dimethylbenz[a]anthracene by two exposure routes at different developmental stages. Toxicol Pathol 2000; 28: 705-15.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Rubinstein AL Zebrafish: from disease modeling to drug discovery. Curr Opin Drug Discov Devel 2003; 6: 218-23.
    OpenUrlPubMed
  16. ↵
    Nesbit CE, Tersak JM, Prochownik EV MYC oncogenes and human neoplastic disease. Oncogene 1999; 18: 3004-16.
    OpenUrlCrossRefPubMed
  17. ↵
    Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science (Wash DC) 1984; 224: 1121-4.
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Seeger RC, Brodeur GM, Sather H, et al Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med 1985; 313: 1111-6.
    OpenUrlCrossRefPubMed
  19. ↵
    Wong AJ, Ruppert JM, Eggleston J, et al Gene amplification of c-myc and N-myc in small cell carcinoma of the lung. Science (Wash DC) 1986; 233: 461-4.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Garson JA, McIntyre PG, Kemshead JT N-myc amplification in malignant astrocytoma. Lancet 1985; 2: 718-9.
    OpenUrl
  21. ↵
    Garson JA, Clayton J, McIntyre P, Kemshead JT N-myc oncogene amplification in rhabdomyosarcoma at release. Lancet 1986; 1: 1496
    OpenUrlCrossRefPubMed
  22. ↵
    Garson JA, Pemberton LF, Sheppard PW, et al N-myc gene expression and oncoprotein characterisation in medulloblastoma. Br J Cancer 1989; 59: 889-94.
    OpenUrlPubMed
  23. ↵
    Lee WH, Murphree AL, Benedict WF Expression and amplification of the N-myc gene in primary retinoblastoma. Nature (Lond) 1984; 309: 458-60.
    OpenUrlCrossRefPubMed
  24. ↵
    Goldhamer DJ, Faerman A, Shani M, Emerson CP, Jr Regulatory elements that control the lineage-specific expression of myoD. Science (Wash DC) 1992; 256: 538-42.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Westerfield M, Doerry E, Kirkpatrick AE, Driever W, Douglas SA An on-line database for zebrafish development and genetics research. Semin Cell Dev Biol 1997; 8: 477-88.
    OpenUrlCrossRefPubMed
  26. ↵
    Bennett CM, Kanki JP, Rhodes J, et al Myelopoiesis in the zebrafish, Danio rerio. Blood 2001; 98: 643-51.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Goldhamer DJ, Brunk BP, Faerman A, et al Embryonic activation of the myoD gene is regulated by a highly conserved distal control element. Development (Camb) 1995; 121: 637-49.
    OpenUrlAbstract
  28. ↵
    Kucharczuk KL, Love CM, Dougherty NM, Goldhamer DJ Fine-scale transgenic mapping of the MyoD core enhancer: MyoD is regulated by distinct but overlapping mechanisms in myotomal and non-myotomal muscle lineages. Development (Camb) 1999; 126: 1957-65.
    OpenUrlAbstract
  29. ↵
    Tomita T New markers for pancreatic islets and islet cell tumors. Pathol Int 2002; 52: 425-32.
    OpenUrlCrossRefPubMed
  30. ↵
    Redecker P, Grube D [Synaptophysin in the nervous system and endocrine cells]. Acta Histochem Suppl 1992; 42: 33-8.
    OpenUrlPubMed
  31. ↵
    Hartroft WS, Wrenshall GA Correlation of beta-cell granulation with extractable insulin of the pancreas; studies in adult human diabetics and nondiabetics. Diabetes 1955; 4: 1-7.
  32. ↵
    Jiang G, Zhang BB Glucagon and regulation of glucose metabolism. Am J Physiol Endocrinol Metab 2003; 284: E671-8.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    O’Connor DT, Deftos LJ Secretion of chromogranin A by peptide-producing endocrine neoplasms. N Engl J Med 1986; 314: 1145-51.
    OpenUrlCrossRefPubMed
  34. ↵
    Reichlin S Secretion of somatostatin and its physiologic function. J Lab Clin Med 1987; 109: 320-6.
    OpenUrlPubMed
  35. ↵
    Wick MR, Graeme-Cook FM Pancreatic neuroendocrine neoplasms: a current summary of diagnostic, prognostic, and differential diagnostic information. Am J Clin Pathol 2001; 115(Suppl): S28-45.
  36. ↵
    Pavelic K, Hrascan R, Kapitanovic S, et al Molecular genetics of malignant insulinoma. Anticancer Res 1996; 16: 1707-17.
    OpenUrlPubMed
  37. ↵
    Pavelic K, Hrascan R, Kapitanovic S, et al Multiple genetic alterations in malignant metastatic insulinomas. J Pathol 1995; 177: 395-400.
    OpenUrlCrossRefPubMed
  38. ↵
    Pelengaris S, Khan M Oncogenic co-operation in beta-cell tumorigenesis. Endocr Relat Cancer 2001; 8: 307-14.
    OpenUrlAbstract
  39. ↵
    Aubry S, Charron J N-Myc shares cellular functions wiht c-Myc. DNA Cell Biol 2000; 19: 353-64.
    OpenUrlCrossRefPubMed
  40. ↵
    Mukherjee B, Morgenbesser SD, DePinho RA Myc family oncoproteins function through a common pathway to transform normal cells in culture: cross-interference by Max and trans-acting dominant mutants. Genes Dev 1992; 6: 1480-92.
    OpenUrlAbstract/FREE Full Text
  41. ↵
    Malynn BA, de Alboran IM, O’Hagan RC, et al N-myc can functionally replace c-myc in murine development, cellular growth, and differentiation. Genes Dev 2000; 14: 1390-9.
    OpenUrlAbstract/FREE Full Text
  42. ↵
    Pelengaris S, Khan M, Evan GI Suppression of Myc-induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell 2002; 109: 321-34.
    OpenUrlCrossRefPubMed
  43. ↵
    Lewis BC, Klimstra DS, Varmus HE The c-myc and PyMT oncogenes induce different tumor types in a somatic mouse model for pancreatic cancer. Genes Dev 2003; 17: 3127-38.
    OpenUrlAbstract/FREE Full Text
  44. ↵
    Toffolatti L, Frascella E, Ninfo V, et al MYCN expression in human rhabdomyosarcoma cell lines and tumour samples. J Pathol 2002; 196: 450-8.
    OpenUrlCrossRefPubMed
View Abstract
PreviousNext
Back to top
Cancer Research: 64 (20)
October 2004
Volume 64, Issue 20
  • Table of Contents
  • About the Cover
  • Index by Author

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Research article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Targeted Expression of Human MYCN Selectively Causes Pancreatic Neuroendocrine Tumors in Transgenic Zebrafish
(Your Name) has forwarded a page to you from Cancer Research
(Your Name) thought you would be interested in this article in Cancer Research.
Citation Tools
Targeted Expression of Human MYCN Selectively Causes Pancreatic Neuroendocrine Tumors in Transgenic Zebrafish
Hong Wei Yang, Jeffery L. Kutok, Nam Hyuk Lee, Hui Ying Piao, Christopher D. M. Fletcher, John P. Kanki and A. Thomas Look
Cancer Res October 15 2004 (64) (20) 7256-7262; DOI: 10.1158/0008-5472.CAN-04-0931

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Targeted Expression of Human MYCN Selectively Causes Pancreatic Neuroendocrine Tumors in Transgenic Zebrafish
Hong Wei Yang, Jeffery L. Kutok, Nam Hyuk Lee, Hui Ying Piao, Christopher D. M. Fletcher, John P. Kanki and A. Thomas Look
Cancer Res October 15 2004 (64) (20) 7256-7262; DOI: 10.1158/0008-5472.CAN-04-0931
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • INTRODUCTION
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Physical and Functional Interaction between hMSH5 and c-Abl
  • An Imprinted Locus Epistatically Influences Nstr1 and Nstr2 to Control Resistance to Nerve Sheath Tumors in a Neurofibromatosis Type 1 Mouse Model
  • Germ-Line Mutation of NKX3.1 Cosegregates with Hereditary Prostate Cancer and Alters the Homeodomain Structure and Function
Show more Molecular Biology, Pathobiology and Genetics
  • Home
  • Alerts
  • Feedback
Facebook  Twitter  LinkedIn  YouTube  RSS

Articles

  • Online First
  • Current Issue
  • Past Issues
  • Meeting Abstracts

Info for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians
  • Reviewers

About Cancer Research

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2018 by the American Association for Cancer Research.

Cancer Research Online ISSN: 1538-7445
Cancer Research Print ISSN: 0008-5472
Journal of Cancer Research ISSN: 0099-7013
American Journal of Cancer ISSN: 0099-7374

Advertisement