Advertisement
Molecular and Cellular Pathobiology

Phytoestrogen Suppresses Efflux of the Diagnostic Marker Protoporphyrin IX in Lung Carcinoma

Hirofumi Fujita, Keisuke Nagakawa, Hirotsugu Kobuchi, Tetsuya Ogino, Yoichi Kondo, Keiji Inoue, Taro Shuin, Toshihiko Utsumi, Kozo Utsumi, Junzo Sasaki and Hideyo Ohuchi
DOI: 10.1158/0008-5472.CAN-15-1484 Published April 2016

Abstract

One promising method to visualize cancer cells is based on the detection of the fluorescent photosensitizer protoporphyrin IX (PpIX) synthesized from 5-aminolevulinic acid (ALA), but this method cannot be used in cancers that exhibit poor PpIX accumulation. PpIX appears to be pumped out of cancer cells by the ABC transporter G2 (ABCG2), which is associated with multidrug resistance. Genistein is a phytoestrogen that appears to competitively inhibit ABCG2 activity. Therefore, we investigated whether genistein can promote PpIX accumulation in human lung carcinoma cells. Here we report that treatment of A549 lung carcinoma cells with genistein or a specific ABCG2 inhibitor promoted ALA-mediated accumulation of PpIX by approximately 2-fold. ABCG2 depletion and overexpression studies further revealed that genistein promoted PpIX accumulation via functional repression of ABCG2. After an extended period of genistein treatment, a significant increase in PpIX accumulation was observed in A549 cells (3.7-fold) and in other cell lines. Systemic preconditioning with genistein in a mouse xenograft model of lung carcinoma resulted in a 1.8-fold increase in accumulated PpIX. Long-term genistein treatment stimulated the expression of genes encoding enzymes involved in PpIX synthesis, such as porphobilinogen deaminase, uroporphyrinogen decarboxylase, and protoporphyrinogen oxidase. Accordingly, the rate of PpIX synthesis was also accelerated by genistein pretreatment. Thus, our results suggest that genistein treatment effectively enhances ALA-induced PpIX accumulation by preventing the ABCG2-mediated efflux of PpIX from lung cancer cells and may represent a promising strategy to improve ALA-based diagnostic approaches in a broader set of malignancies. Cancer Res; 76(7); 1837–46. ©2016 AACR.

Introduction

Protoporphyrin IX (PpIX) functions as a fluorescent photosensitizer, which is synthesized from 5-aminolevulinic acid (ALA). As PpIX preferentially accumulates in malignant tissues (1), the exogenous administration of ALA enables us to detect tumors exhibiting enhanced PpIX fluorescence. This technology, referred to as photodynamic diagnosis, has been widely used clinically, especially during surgery for bladder cancer (2), prostate cancer (3), and brain tumors (4), to identify precise tumor margins and prevent overlooking small lesions that are otherwise invisible. However, ALA-based photodynamic diagnosis remains unsatisfactory in diagnosing some tumors that accumulate insufficient amounts of PpIX (5–9).

Successful ALA-induced PpIX accumulation may rely on the activity of enzymes that synthesize and metabolize PpIX and on the proteins that transport PpIX (10, 11). Exogenously added ALA is taken up by target cells and metabolized to coproporphyrinogen III in the cytosol by several enzymes, which include porphobilinogen deaminase (PBGD), uroporphyrinogen III synthase (UROS), which is the rate-limiting enzyme of porphyrin metabolism (12), and uroporphyrinogen decarboxylase (UROD). Coproporphyrinogen III is then translocated into mitochondria through ATP-binding cassette (ABC) transporter B6 and metabolized to PpIX by coproporphyrinogen oxidase (CPOX) and protoporphyrinogen oxidase (PPOX; refs. 5, 7). PpIX is metabolized further to heme by ferrochelatase. Furthermore, accumulating evidence indicates that the elimination of PpIX from cells is carried out by ABC transporter G2 (ABCG2), which is a multidrug resistance-associated protein (11). Thus, heme synthesis enzymes and ABCG2 play important roles in regulating the cellular accumulation of PpIX in cancer. Our current research goal is to develop new combination regimens with compounds that enhance the accumulation of PpIX to improve ALA-induced PpIX accumulation. A recent study reported that the systemic administration of vitamin D3 for preconditioning significantly increased the accumulation of PpIX in squamous tumor cell lines both in vitro and in vivo (13). The underlying mechanism involves increases in the expression of CPOX and decreases in that of ferrochelatase. We previously reported that the iron chelator deferoxamine promoted the accumulation of PpIX in urothelial carcinoma in vitro and in vivo as well as in prostate cancer, oral squamous cell carcinoma, and histiocytic lymphoma in vitro (14–17). Furthermore, the inhibition of ABCG2 by specific inhibitors or knockdown using RNAi facilitated the ALA-mediated accumulation of PpIX (8, 18, 19). Therefore, the use of compounds that stimulate the synthesis of PpIX or block the efflux of PpIX may become a good strategy to improve ALA-induced PpIX accumulation.

Estrogens are known to induce porphyria cutanea tarda, which is characterized clinically by cutaneous photosensitivity and the excessive excretion of porphyrins (20). This effect of estrogen is supported by the findings of another study using cancer-bearing female rats in which estrogen depletion by ovariectomy caused a significant reduction in ALA-induced PpIX levels and PBGD activity in tumors (21). On the other hand, a phytoestrogen genistein known as a tyrosine kinase inhibitor was found to exhibit estrogen-like activity by interacting with estrogen receptors (ER) in mammals (22–24). Furthermore, a previous study reported that genistein reversed ABCG2-mediated multidrug resistance and genistein was likely to competitively inhibit the efflux of anticancer agents such as SN-38 and mitoxantrone by ABCG2 (25).

These findings prompted us to hypothesize that genistein promotes the accumulation of PpIX by increasing the synthesis of PpIX and/or reducing the efflux of PpIX. However, the effects of genistein on the accumulation of PpIX have not yet been elucidated.

Therefore, we herein determined whether genistein increased the accumulation of PpIX in vitro and in a xenograft model using the human lung carcinoma A549 cell line, which expresses high levels of the endogenous ABCG2 protein.

Materials and Methods

Chemicals

ALA was purchased from COSMO OIL. The iron chelator deferoxamine, genistein, Ko143, FBS, and G418 were obtained from Sigma-Aldrich. RPMI1640 medium was obtained from Wako. (Z)-1-[N-(2-Aminoethyl)-N-(2-ammonioethyl)-amino]diazen-1-ium-1,2- diolate (NOC18) was obtained from Dojindo. The antibody to ABCG2 was obtained from Cell Signaling Technology. The monoclonal anti-actin antibody (clone C4) was from Millipore. The anti-ferrochelatase antibody was a gift from Dr. S. Taketani (Kyoto Institute of Technology, Kyoto, Japan). MitoTracker Green was obtained from Invitrogen. The BCA Protein Assay Kit was from Thermo Scientific. All other chemicals were of analytic grade and obtained from Nacalai Tesque. Deferoxamine was dissolved in saline as a stock solution. Genistein, Ko143, and MitoTracker Green were dissolved in DMSO and stored in aliquots at −20°C until use. ALA was diluted in ultrapure water to make a stock solution of 0.5 mol/L.

Cell lines and culture conditions

The following cell lines were purchased from the Japanese Collection of Research Bioresources: A549, HEK293T, T98G, T24, MDA-MB-231, MeWo, DLD-1, and H1299. U937 and HL-60 cell lines were obtained from the RIKEN Cell Bank. These cell lines were authenticated using short tandem repeat analysis with the GenePrint 10 System (Promega) and Cell Line Authentication Database of JCRB and ATCC in 2015. ST-HEK cells were prepared by the stable transfection of ABCG2 and cells expressing high levels of the functional ABCG2 protein (18). These cells were maintained in complete medium: RPMI1640 supplemented with 10% heat-inactivated FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin in a humidified atmosphere with 5% CO2/air at 37°C. Typically, 1 × 105 cells were seeded in 1.5 mL of complete medium on 3.5-cm dishes and cultured for 24 hours before each experiment. Unless otherwise indicated, chemicals were added at the following final concentrations: 0.5 mmol/L of ALA, 5 to 50 μmol/L of genistein, 1 μmol/L of Ko143, and 300 μmol/L of Noc18.

Flow cytometry of cellular PpIX

After being incubated, cells were rinsed three times with PBS and harvested by trypsinization. After centrifugation at 800 × g for 5 minutes, the cells were resuspended in 0.4 mL of PBS. Cellular PpIX contents were measured using the flow cytometer FACScan (BD Biosciences) and quantified with CellQuest software (BD Biosciences). A total of 10,000 cells were analyzed in each sample (excitation 488 nm, emission 650 nm).

Fluorescence microscopy

After being treated with ALA, cells were stained with 1 μmol/L MitoTracker Green for 20 minutes at 37°C and then observed by fluorescence microscopy (Axiovert 200, Carl Zeiss Inc.). MitoTracker Green is a fluorescent dye compound that is used for the detection of mitochondria. Fluorescence images were taken using a highly light-sensitive thermoelectrically cooled charge-coupled device camera (Axio-Cam CCD camera, Zeiss). The filter combinations were a 450-nm excitation filter, 510-nm beam splitter, and 515 to 565-nm emission filter for MitoTracker green; a 400-nm excitation filter, 580-nm beam splitter, and 590-nm long-pass emission filter for PpIX.

Western blot analysis

Cells were solubilized in ice-cold lysis buffer (20 mmol/L Tris-HCl, pH 7.4, 0.15 mol/L NaCl, 1% NP-40, 0.1% SDS, 0.1% sodium deoxycholate, 5 mmol/L ethylenediaminetetraacetic acid (EDTA), 5 mmol/L ethylene glycol tetraacetic acid (EGTA), 1 mmol/L phenylmethylsulfonylfluoride, and 1 mg/mL each of leupeptin and pepstatin A). After centrifugation of the homogenate at 15,000 × g for 15 minutes to remove cell nuclei, the supernatant was collected and the protein content was determined using a BCA Protein Assay Kit. Samples were prepared by mixing with 2× SDS sample buffer and boiling for 5 minutes, and were then stored at −80°C until use. Protein content was determined using a BCA protein assay kit. The samples were subjected to SDS-PAGE and proteins in the gel were transferred electrophoretically onto an Immobilon membrane (Millipore). The membrane was blocked by 5% skim milk in Tris–buffered saline tween 20 (TBST; 0.15 mol/L NaCl, 0.05% Tween 20, 10 mmol/L Tris-HCl, pH 7.4) and then incubated overnight with primary antibodies (1:1,000 for the mouse anti-human actin antibody, 1:300 for the rabbit anti-human ABCG2 antibody, and 1:1,000 for the rabbit anti-bovine ferrochelatase antibody) diluted in TBST containing 5% skim milk at 4°C. After washing three times with TBST, the membrane was incubated for 1.5 hours with the horseradish peroxidase -conjugated secondary antibody diluted at 1:5,000 in TBST containing 5% skim milk at room temperature. Immunoreactive bands ware visualized with Immunostar LD and exposed to Polaroid films.

qRT-PCR

Total RNA was isolated from A549 cells treated with or without 50 μmol/L genistein for 28 hours using RNeasy Mini Kit (Qiagen) following the manufacturer's instructions. The RNA was treated with a TURBO DNA-free kit (ThermoFisher Scientific) to remove genomic DNA. cDNA was prepared from 0.5 μg of total RNA using Revertra Ace qPCR RT master Mix (TOYOBO). One-twentieth of each of the obtained cDNA specimens was used for each PCR. qRT-PCR was performed in LightCycler 8-Tube Strips using the LightCycler Nano Instrument and FastStart Essential DNA Green Master (Roche). The primers used to amplify heme synthesis genes and an internal standard β-actin were: human ALAD forward primer CCTCGGTTCCAACCAACTGAT, ALAD reverse primer: GATAGGVTGTATGTCATCAGGAACA; human PBGD forward primer CAAGGACCAGGACATCTTGGAT, PBGD reverse primer: CCAGACTCCTCCAGTCAGGTACA; human UROS forward primer TCAGCACTGCCTCTTCTATTTCC, UROS reverse primer: CTGGGTGTGCAACTGTCTGATAC; human UROD forward primer CGGGAGTGTGTGGGAA, UROD reverse primer: AAGCAGACGTGAGTGTTTATGCA; human CPOX forward primer GGCGGAGATGTTGCCTAAGAC, CPOX reverse primer: AATGCTCACCCCAGCCTTTT; human β-actin forward primer TGGCACCCAGCACAATGAA, β-actin reverse primer: CTAAGTCATAGTCCGCCTAGAAGCA; The PCR protocol was 95°C for 10 minutes followed by 40 cycles of denaturation at 95°C for 15 seconds and annealing/extension at 60°C for 1 minute.

Generation of an in vivo tumor xenograft model

All animal procedures were approved by the Okayama University Institutional Animal Care and Use Committee (approval number: OKU-2012634 and OKU-2015443). Male athymic nude mice (BALB/c nu/nu) were obtained from Charles River Japan, Inc. and they received intradermal injections of 2 × 106 A549 cells in each flank. After 2 weeks, visible nodules approximately 5 mm in diameter had formed. Mice (n = 5 per group) received vehicle (50% ethanol in PBS) or genistein [10 mg/kg/day, intraperitoneally (i.p.) daily for 3 days] as a preconditioning treatment. Zero, 1, 4, 12, and 24 hours after the administration of ALA [75 mg/kg, intramuscularly (i.m.)] to both groups, the mice were euthanized and the tumors and neighboring normal-appearing tissues were harvested, embedded in optimal cutting temperature compound (Sakura Finetek), and frozen in liquid nitrogen. Sections were cut (15-μm thickness) and five consecutive sections were mounted on separate Superfrost Plus glass slides (Thermo Fisher Scientific). PpIX was detected without fixation with a 400-nm excitation filter, a 565-nm beam splitter, and a 605/70 nm bandpass emission filter on a fluorescence microscope (BZ-X700, KEYENCE). Sections containing tumor tissue and neighboring normal-appearing tissue were identified and analyzed with BZ-X Analyzer software (KEYENCE). Detection of E-cadherin was used to distinguish the tumor tissues and nontumor tissues, as described below. PpIX fluorescence was measured as reported previously (13) with the following modifications. The PpIX signal intensity per unit area was measured separately in the tumor and nontumor tissues by calculating the mean intensity of the red fluorescence in each pixel of each digital image. The ratios of tumor PpIX signal per unit area and nontumor PpIX signal per unit area were compared.

E-cadherin IHC

Frozen sections adjacent to the sections used for PpIX detection were fixed in 4% paraformaldehyde for 10 minutes and then were incubated with blocking solution (5% goat serum and 0.25% Triton X-100 in PBS) for 30 minutes at room temperature. The sections were incubated with the anti-E-cadherin antibody diluted 1:200 in IMMUNO SHOT (Cosmobio) for 16 hours at 4°C. After washing, Alexa488-labeled secondary antibodies were diluted 1:750 for 1.5 hours at room temperature. Cell nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI). The slides were mounted with the antifade mountant, SlowFade Gold (Life Technologies). The sections were analyzed by confocal microscopy (ZEISS Confocal Laser Scanning Microscope Model LSM780) or BZ-X700.

Statistical analysis

Statistical analyses were performed using the Student t test. The mean of three distributions was considered significantly different if P < 0.05.

Results

Effects of genistein on ALA-mediated accumulation of PpIX in A549 cells

To determine whether genistein promoted the ALA-mediated accumulation of PpIX by inhibiting ABCG2, we examined the relationship between the abundance of ABCG2 and effects of genistein on the accumulation of PpIX. A Western blot analysis confirmed that A549 cells had a high content of ABCG2, whereas human histiocytic lymphoma U937 cells had a low content of ABCG2 (Fig. 1A; ref. 18). The ALA-mediated accumulation of PpIX was significantly lower in A549 cells than in U937 cells (Fig. 1B). Genistein increased the ALA-mediated accumulation of PpIX in A549 cells in dose- and time-dependent manners, which was similar to the effects of the specific ABCG2 inhibitor Ko143 (Fig. 1C and D). In contrast, neither Ko143 nor genistein promoted the ALA-mediated accumulation of PpIX in U937 cells (Fig. 1E). When heme synthesis was inhibited by the FEHC inhibitor Noc18 (NO donor), cellular PpIX levels increased significantly in U937 cells and A549 cells (Fig. 1E and F). Fluorescence microscopy revealed that accumulated PpIX mainly localized in mitochondria (Fig. 2). These results indicated that the ALA-mediated accumulation of PpIX was facilitated by genistein in A549 cells in vitro.

Figure 1.
Figure 1.

Effects of genistein on ALA-mediated accumulation of PpIX in ABCG2-expressing cells. A, protein expression of ABCG2 and ferrochelatase (FECH) in U937 and A549 cells. Cell lysates were analyzed by Western blotting using antibodies against ABCG2, ferrochelatase, and actin. B, the ALA-mediated accumulation of PpIX in U937 and A549 cells. Cells were treated with the indicated concentration of ALA for 3 hours. PpIX fluorescence was measured by a flow cytometer and expressed as a percentage of the control (0 mmol/L ALA). C, genistein (left graph) and Ko143 (an ABCG2 inhibitor, right graph) treatments stimulated ALA-mediated accumulation of PpIX in A549 cells in a dose-dependent manner. D, genistein and Ko143 stimulated ALA-mediated accumulation of PpIX in A549 cells in a time-dependent manner. Data in C are percent increases relative to the PpIX fluorescence intensity induced by 0.5 mmol/L ALA only. E and F, effects of genistein, Ko143, and Noc18 (ferrochelatase inhibitor) on the ALA-induced accumulation of PpIX in U937 (E) and A549 (F) cells. Cells were incubated with 0.5 mmol/L ALA for 3 hours in the presence or absence of 1 μmol/L Ko143, 25 μmol/L genistein, or 300 μmol/L Noc18 and intracellular PpIX fluorescence was measured. The mean ± SD for three independent experiments. Asterisks, a significant difference from ALA only.

Figure 2.
Figure 2.

Effects of genistein and Ko143 on the amount and distribution of PpIX in ALA-treated A549 cells in vitro. Cells were incubated with 0.5 mmol/L ALA for 3 hours in the presence or absence of 1 μmol/L Ko143 or 25 μmol/L genistein and then stained with MitoTracker Green, a mitochondrial-selective probe. Images were taken using fluorescent microscopy. Magnification, ×200.

Genistein stimulated PpIX accumulation by the functional repression of ABCG2

As genistein stimulated the ALA-mediated accumulation of PpIX in a similar manner to that of the ABCG2 inhibitor, we expected genistein to suppress the efflux of PpIX through ABCG2. Thus, we examined the effects of genistein on the accumulation of PpIX in ABCG2-knockdown cells. Figure 3A shows that the siRNA designed to silence the ABCG2 gene obliterated the protein expression of ABCG2 in A549 cells. After the accumulation of PpIX was induced with ALA, washing the control cells with ALA-free medium significantly decreased the accumulated levels of PpIX in 3 hours. On the other hand, large amounts of PpIX still remained in ABCG2-knockdown cells after washing (Fig. 3B). When control cells were washed in the presence of Ko143 or genistein, larger amounts of PpIX were retained in the cells. The accumulation of PpIX in ALA-treated ABCG2-knockdown cells was greater with Noc18, which inhibits ferrochelatase through the generation of NO, but not with Ko143 or genistein than that in control cells. These results suggested that the efflux of PpIX by ABCG2 and heme synthesis were major factors regulating the intracellular accumulation of PpIX in A549 cells and also that genistein suppressed the efflux of intracellular PpIX by ABCG2.

Figure 3.
Figure 3.

Genistein (Geni) stimulated PpIX accumulation by functionally repressing ABCG2. A and B, ABCG2 protein expression in A549 cells was knocked down by RNAi, and the effects of genistein on PpIX excretion/consumption were determined by removing the substrate. Cells were transfected with ABCG2-specific siRNA for 5 days, treated with ALA for 1.5 hours, rinsed with ALA-free medium, and then incubated in the medium for 3 hours in the presence of 1 μmol/L Ko143, 25 μmol/L genistein, or 300 μmol/L Noc18. A, Western blot for the ABCG2 protein from ABCG2-knockdown A549 cells. B, PpIX levels were measured by flow cytometry. Asterisks, a significant difference from the corresponding “control cells.” #, a significant difference from the corresponding “Wash” samples. C, ABCG2 protein expression in parental HEK cells and ST-HEK cells, in which an ABCG2 expression vector was stably transfected. D, effects of genistein on the accumulation of PpIX in HEK cells and ST-HEK cells. HEK cells and ST-HEK cells were incubated with 0.5 mmol/L ALA for 3 hours in the presence of 1 μmol/L Ko143 or 25 μmol/L genistein. The mean ± SD for three independent experiments. Asterisks, a significant difference from the corresponding “ALA” samples.

We then investigated the effects of genistein on the ALA-mediated accumulation of PpIX in ABCG2-overexpressing HEK cells (ST-HEK cells, Fig. 3C). The ALA treatment failed to increase the accumulation of PpIX in ST-HEK cells, which was in contrast to that in parental HEK cells. However, these two cells showed the higher or similar accumulation of PpIX when cells were treated with Ko143 or genistein, respectively (Fig. 3D). These results suggested that genistein suppressed the PpIX efflux function of ABCG2 in HEK cells.

A longer genistein treatment markedly stimulated ALA-mediated accumulation of PpIX

We also examined the effects of a longer genistein treatment for up to 48 hours on the ALA-mediated accumulation of PpIX in A549 cells. The accumulation of PpIX was markedly higher by ALA + genistein than by ALA alone or ALA + Ko143 (Fig. 4A). The ABCG2-inhibitory activity of Ko143 was not affected by the incubation in culture medium for 48 hours (data not shown). Fluorescence microscopy revealed that the ALA + genistein treatment for 48 hours increased PpIX fluorescence in A549 cells and that PpIX was localized in the cytosol and mitochondria, which was similar to that with ALA alone (Fig. 4B). Furthermore, the pretreatment with genistein significantly increased the ALA-mediated accumulation of PpIX in a manner that depended on the dose of genistein and time of the pretreatment (Fig. 5A and 5B). In addition, genistein enhanced ALA-mediated PpIX accumulation in another lung carcinoma cell line, H1299, and also in various tumor cell lines that express ABCG2, including glioblastoma T98G cells, breast cancer MDA-MB-231 cells, melanoma MeWo cells, and colorectal adenocarcinoma DLD-1 cells (Supplementary Fig. S1A and S1B). Importantly, genistein pretreatment also enhanced the cell death induced by ALA-mediated photodynamic treatment in A549 cells (Supplementary Fig. S1C). As estrogen and estrogenic compounds often stimulate the proliferation of cancer cells (26–28), the effect of genistein on the cell growth of A549 cells was examined. As shown in Fig. 5C, 25 and 50 μmol/L genistein inhibited the cell growth of A549 cells for 48 hours.

Figure 4.
Figure 4.

A longer genistein treatment markedly stimulated ALA-mediated accumulation of PpIX. A, cells were treated with 0.5 mmol/L ALA for 48 hours in the presence of 1 μmol/L Ko143 or 50 μmol/L genistein and PpIX fluorescence was analyzed by flow cytometry. B, the amount and distribution of PpIX at 48 hours were analyzed by fluorescence microscopy. Magnification, ×200. MitoTracker Green is a mitochondrial-sensitive probe.

Figure 5.
Figure 5.

The genistein pretreatment stimulated ALA-mediated accumulation of PpIX. A, A549 cells were treated with the indicated concentration of genistein for 48 hours and then with 0.5 mmol/L ALA + genistein for 3 hours. PpIX fluorescence was analyzed by flow cytometry. B, preincubation time-dependent accumulation of ALA-mediated PpIX by genistein. C, effects of genistein on A549 cell growth at 48 hours. Cell growth was analyzed with a hemocytometer and the Trypan blue exclusion test. Asterisks, genistein significantly increased the accumulation of PpIX. Data are the mean ± SD derived from three independent experiments.

Systemic preconditioning with genistein enhanced the accumulation of PpIX in a tumor model established in vivo

To determine whether genistein can enhance the accumulation of PpIX in tumor cells in vivo, nude mice were implanted with A549 adenocarcinoma cells. After 2 weeks, the tumors were visible and the animals received systemic preconditioning with vehicle or genistein over a 3-day period. On the third day, ALA was injected intramuscularly and both tumor-bearing and nontumor tissues were harvested 0, 1, 4, 12, and 24 hours later and were analyzed for PpIX fluorescence. In the vehicle control, ALA was found to induce a transient accumulation of PpIX in the xenografted tumor cells (Supplementary Fig. S2A), which was confirmed with the detection of E-cadherin immunoreactivity in the tumor tissues. PpIX accumulation peaked 4 hours after the administration of ALA (Supplementary Fig. S2A), although, the fluorescence intensity ratio for PpIX between the tumor and nontumor tissues was relatively low at the same time point (1.49 ± 0.31). The greatest contrast in PpIX fluorescence was observed 1 hour after ALA administration, and at the same time point the genistein pretreatment significantly increased PpIX accumulation in the xenografted tumor (Fig. 6A–C). Moreover, this increase in PpIX accumulation did not affect the tumor:nontumor PpIX fluorescence ratio (Fig. 6C). Treatment with genistein also increased the accumulation of PpIX in the normal epidermis and hair follicles (Supplementary Fig. S2B and S2C), suggesting that genistein promotes PpIX accumulation in proliferating tissues such as skin.

Figure 6.
Figure 6.

Preconditioning with genistein stimulated the accumulation of PpIX in a xenograft tumor model and promoted the gene expression of heme metabolism enzymes in A549 cells. A, histologic detection of PpIX levels in A549 tumor cells established in nude mice as a xenograft model (see Materials and Methods). These mice received genistein (10 mg/kg, daily, i.p.) for 3 days and ALA (75 mg/kg, i.m.) for 1 hour to stimulate the synthesis of PpIX before the tumors were analyzed. Wide-field and confocal fluorescence photomicrographs of frozen sections showed PpIX fluorescence and E-cadherin immunoreactivity, respectively. Asterisk, calcified tissue. Scale bar, 300 μm. B, digital quantification of PpIX fluorescence in A549 tumors subjected to genistein as shown in A. PpIX signal per unit area in the E-cadherin positive region was calculated and expressed as a percentage of vehicle PpIX fluorescence. Data are the mean ± SD calculated from five samples. Asterisks, a significant difference from the vehicle control. C, the ratio of PpIX fluorescence in the tumor to that in adjacent nontumor tissue is shown. D, Western blot analysis of protein levels. A549 cells were treated with 50 μmol/L genistein for the indicated times in vitro. Proteins were analyzed by Western blotting. E, changes in the mRNA expression of heme metabolism enzymes in A549 cells treated with genistein in vitro. These mRNAs were analyzed by quantitative real-time PCR. Asterisks, a significant difference from the 0-h control of each gene of interest. FECH, ALAD, PBGD, UROS, UROD, CPOX, and PPOX are ferrochelatase (FECH), ALA dehydrogenase, PBGD, UROS, UROD, CPOX, and PPOX, respectively. F, the rate of PpIX synthesis in genistein-treated A549 cells. A549 cells were treated with or without 50 μmol/L genistein for 48 hours and then treated with 0.5 mmol/L ALA for 1 and 2 hours in the presence of Noc18 and Ko143.

We also attempted to elucidate the mechanism by which the long-term treatment with genistein increased the accumulation of PpIX in vitro. We examined whether genistein affected the expression of ABCG2 in A549 cells. Figure 6D showed that genistein did not suppress, but rather increased the protein expression of ABCG2. We investigated the effects of genistein on the gene expression of heme synthesis enzymes. The gene expression of ALAD, PBGD, UROS, UROD, CPOX, and PPOX was stimulated by the genistein treatment (Fig. 6E). Accordingly, the rate of PpIX synthesis was also accelerated by the genistein pretreatment for 48 hours when the efflux of PpIX by ABCG2 and its consumption by ferrochelatase were inhibited by Ko143 and Noc18 (Fig. 6F). These results suggested that the long-term treatment with genistein increased the accumulation of PpIX by upregulating gene expression involved in the synthesis of PpIX.

Discussion

The enhanced accumulation of PpIX in tumor cells represents a critical issue for successful ALA-mediated photodynamic diagnosis. In the current study, we showed that genistein stimulated the accumulation of PpIX in A549 human lung adenocarcinoma cell line both in vitro and in vivo by preventing ABCG2-mediated PpIX efflux and upregulating the gene expression of heme synthesis enzymes (Fig. 7). Furthermore, the enhancement of PpIX accumulation by genistein was not limited to the A549, lung adenocarcinoma cell line, and similar accumulation patterns were observed in other tumor cell lines. Thus, genistein appears to effectively improved ALA-induced PpIX accumulation in ABCG2 expressing tumors in vitro and in vivo and these findings suggest that the phytoestrogen, genistein, may represent a potentiating agent for ALA-mediated photodynamic diagnosis in humans.

Figure 7.
Figure 7.

Schematic representation of potential mechanisms by which phytoestrogen genistein stimulates ALA-mediated accumulation of PpIX in malignant cells. FECH, ALAD, PBGD, UROS, UROD, CPOX, PPOX, and PEPT are ferrochelatase (FECH), ALA dehydrogenase, PBGD, UROS, UROD, CPOX, PPOX, and oligopeptide transporter, respectively.

Various approaches have been attempted to promote the accumulation of PpIX in tumors by regulating key factors in the synthesis and metabolism of PpIX. The inhibition of heme synthesis by deferoxamine has been shown to improve the ALA-induced accumulation of PpIX in urothelial carcinoma, leukemia, and gastric cancer (15–17, 29–31). However, the anemic conditions commonly observed in patients with cancer may limit the use of such an iron chelator to locally. A treatment with an ABCG2 inhibitor alone or in combination with ferrochelatase inhibitors was shown to significantly increase the ALA-mediated accumulation of PpIX in human urothelial and oral squamous cell carcinoma in vitro (8, 19). Vitamin D3 has also been reported to promote the ALA-mediated accumulation of PpIX by increasing the protein expression of the heme synthesis enzyme CPOX (13). In this context, our results demonstrated for the first time that genistein promoted the accumulation of PpIX by regulating multiple key factors in the accumulation of PpIX such as ABCG2, ALAD, PBGD, UROS, UROD, and PPOX in A549. Furthermore, the combination of these approaches such as the genistein treatment with vitamin D3 may improve ALA-induced PpIX accumulation more efficiently, which is the next subject to be explored.

Genistein has a structural similarity to 17β-estradiol, which explains its estrogenic activity (32). Genistein binds to ERα and ERβ, and its affinity to ERβ is similar to that of 17β-estradiol (22). Although the stimulation of ERβ by its selective agonist 2,3-bis (4-hydroxyphenyl) propionitrile was previously shown to promote the activation of ERK1/2 and cell growth in 201T human non–small cell lung cancer cells (33), genistein did not stimulate the proliferation of A549 cells expressing ERβ (Fig. 1 and 5C; refs. 34–36). Furthermore, estrogen depletion by ovariectomy in rats reduced ALA-induced PpIX levels in the tumors of these animals (21). These findings suggest that estrogen and the phytoestrogen genistein may accelerate the accumulation of PpIX by stimulating ERβ signaling.

Porphyria cutanea tarda is a metabolic disease of the heme synthesis pathway and is characterized by vesicles, bullae, and the fragility of skin and sclerodermoid changes that occur predominantly in sun-exposed areas (37,38). This disorder is biochemically characterized by the accumulation of uroporphyrin and hepta-carboxyl porphyrin in the liver (39). Uroporphyrin and hepta-carboxyl porphyrin circulate in the plasma and mediate cutaneous photosensitivity. It is widely accepted that estrogen is one of the environmental factors of porphyria cutanea tarda and the use of estrogen also plays a role its clinical expression (37, 39). In this context, it is important to note that genistein pretreatment increased ALA-induced PpIX accumulation in the mouse normal epidermis and hair follicles as well as in xenografted tumor in the current study. Thus, estrogens may be good candidates of potentiating agents for ALA-mediated photodynamic diagnosis in humans.

Genistein is known to enhance apoptosis induced by the anticancer drug trichostatin A in A549 cells, but not in normal human lung fibroblasts by increasing the expression of ERβ-mediated TNF receptor-1 (40, 41). Therefore, genistein may be beneficial not only for improving the quality of ALA-mediated photodynamic diagnosis, but also for better outcomes of subsequent chemotherapy in patients with lung cancer.

In the current study, ALA-induced PpIX accumulation increased 3.7-fold in vitro and 1.8-fold in vivo following pretreatment with genistein (Figs. 5B and 6B). This discrepancy between the in vitro and in vivo results may be multifactorial. One possible explanation is that genistein can be metabolized to 3′-OH-genistein by cytochrome P450 1A2 (CYP1A2), a major enzyme in the phase I hydroxylation process in mouse liver (42, 43). Another consideration is that passive targeting systems [e.g., tumor targeting nanoparticles (44)] may improve the effects of genistein in vivo by achieving a better distribution of genistein among cancer cells.

When ALA-induced PpIX is activated by visible light in tumor cells, cytotoxic singlet oxygens are generated and these can kill the tumor cells. In the current study, cell death due to ALA-based photodynamic treatment increased 1.8-fold and PpIX accumulation increased 3.7-fold following 50 μmol/L genistein pretreatment. The mild increase in cytotoxicity despite a marked PpIX increase suggests that genistein partially acts as an antioxidant (45). In addition, genistein has been shown to upregulate the expression of antioxidant genes via ERs and ERK1/2 activation (46). Thus, it is possible that some of the cytotoxic effects that are mediated by ALA-based photodynamic treatment in the presence of genistein may be cancelled by genistein itself.

In the current study, the 48-hour genistein treatment was associated with an increase, rather than a decrease in ABCG2 protein expression, despite the treatment markedly promoting the ALA-mediated accumulation of PpIX in A549 cells. Although the reason for this apparent discrepancy currently remains unknown, it may reflect the multifaceted functions of genistein. Namely, the synthesis of PpIX by genistein-induced heme synthesis enzymes may override the efflux of PpIX by genistein-induced ABCG2 in A549 cells and/or genistein may suppress preexisting and genistein-induced ABCG2 protein levels.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Authors' Contributions

Conception and design: H. Fujita, T. Ogino, T. Shuin

Development of methodology: K. Nagakawa

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): H. Fujita, K. Nagakawa, H. Kobuchi, T. Shuin, T. Utsumi, K. Utsumi

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): H. Fujita, K. Nagakawa, T. Ogino, T. Shuin, H. Ohuchi

Writing, review, and/or revision of the manuscript: H. Fujita, K. Nagakawa, T. Ogino, Y. Kondo, T. Shuin, K. Utsumi, J. Sasaki, H. Ohuchi

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): H. Fujita, H. Kobuchi, Y. Kondo, T. Shuin, T. Utsumi, K. Utsumi, H. Ohuchi

Study supervision: H. Fujita, K. Inoue, T. Shuin, J. Sasaki, H. Ohuchi

Other (senior Author and I made an equal contribution): K. Nagakawa

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Footnotes

  • Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/).

  • ↵†Deceased.

  • Received June 3, 2015.
  • Revision received October 22, 2015.
  • Accepted November 18, 2015.

References

  1. 1.↵
    1. Peng Q,
    2. Warloe T,
    3. Berg K,
    4. Moan J,
    5. Kongshaug M,
    6. Giercksky KE,
    7. et al.
    5-Aminolevulinic acid-based photodynamic therapy. Clinical research and future challenges. Cancer 1997;79:2282–308.
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Inoue K,
    2. Fukuhara H,
    3. Shimamoto T,
    4. Kamada M,
    5. Iiyama T,
    6. Miyamura M,
    7. et al.
    Comparison between intravesical and oral administration of 5-aminolevulinic acid in the clinical benefit of photodynamic diagnosis for nonmuscle invasive bladder cancer. Cancer 2012;118:1062–74.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Fukuhara H,
    2. Inoue K,
    3. Satake H,
    4. Tamura K,
    5. Karashima T,
    6. Yamasaki I,
    7. et al.
    Photodynamic diagnosis of positive margin during radical prostatectomy: preliminary experience with 5-aminolevulinic acid. Int J Urol 2011;18:585–91.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Friesen SA,
    2. Hjortland GO,
    3. Madsen SJ,
    4. Hirschberg H,
    5. Engebraten O,
    6. Nesland JM,
    7. et al.
    5-Aminolevulinic acid-based photodynamic detection and therapy of brain tumors (review). Int J Oncol 2002;21:577–82.
    OpenUrlPubMed
  5. 5.↵
    1. Messmann H,
    2. Mlkvy P,
    3. Buonaccorsi G,
    4. Davies CL,
    5. MacRobert AJ,
    6. Bown SG
    . Enhancement of photodynamic therapy with 5-aminolaevulinic acid-induced porphyrin photosensitisation in normal rat colon by threshold and light fractionation studies. Br J Cancer 1995;72:589–94.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Teng L,
    2. Nakada M,
    3. Zhao SG,
    4. Endo Y,
    5. Furuyama N,
    6. Nambu E,
    7. et al.
    Silencing of ferrochelatase enhances 5-aminolevulinic acid-based fluorescence and photodynamic therapy efficacy. Br J Cancer 2011;104:798–807.
    OpenUrlCrossRefPubMed
  7. 7.↵
    1. Togsverd-Bo K,
    2. Lerche CM,
    3. Philipsen PA,
    4. Poulsen T,
    5. Wulf HC,
    6. Haedersdal M
    . Porphyrin biodistribution in UV-exposed murine skin after methyl- and hexyl-aminolevulinate incubation. Exp Dermatol 2012;21:260–4.
    OpenUrlCrossRefPubMed
  8. 8.↵
    1. Yamamoto M,
    2. Fujita H,
    3. Katase N,
    4. Inoue K,
    5. Nagatsuka H,
    6. Utsumi K,
    7. et al.
    Improvement of the efficacy of 5-aminolevulinic acid-mediated photodynamic treatment in human oral squamous cell carcinoma HSC-4. Acta Med Okayama 2013;67:153–64.
    OpenUrlPubMed
  9. 9.↵
    1. Zhao SG,
    2. Chen XF,
    3. Wang LG,
    4. Yang G,
    5. Han DY,
    6. Teng L,
    7. et al.
    Increased expression of ABCB6 enhances protoporphyrin IX accumulation and photodynamic effect in human glioma. Ann Surg Oncol 2013;20:4379–88.
    OpenUrlCrossRefPubMed
  10. 10.↵
    1. Ishizuka M,
    2. Abe F,
    3. Sano Y,
    4. Takahashi K,
    5. Inoue K,
    6. Nakajima M,
    7. et al.
    Novel development of 5-aminolevurinic acid (ALA) in cancer diagnoses and therapy. Int Immunopharmacol 2011;11:358–65.
    OpenUrlCrossRefPubMed
  11. 11.↵
    1. Kuo MT
    . Redox regulation of multidrug resistance in cancer chemotherapy: molecular mechanisms and therapeutic opportunities. Antioxid Redox Signal 2009;11:99–133.
    OpenUrlCrossRefPubMed
  12. 12.↵
    1. Doss M,
    2. Sixel-Dietrich F,
    3. Verspohl F
    . "Glucose effect" and rate limiting function of uroporphyrinogen synthase on porphyrin metabolism in hepatocyte culture: relationship with human acute hepatic porphyrias. J Clin Chem Clin Biochem 1985;23:505–13.
    OpenUrlPubMed
  13. 13.↵
    1. Anand S,
    2. Wilson C,
    3. Hasan T,
    4. Maytin EV
    . Vitamin D3 enhances the apoptotic response of epithelial tumors to aminolevulinate-based photodynamic therapy. Cancer Res 2011;71:6040–50.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    1. Amo T,
    2. Kawanishi N,
    3. Uchida M,
    4. Fujita H,
    5. Oyanagi E,
    6. Utsumi T,
    7. et al.
    Mechanism of cell death by 5-aminolevulinic acid-based photodynamic action and its enhancement by ferrochelatase inhibitors in human histiocytic lymphoma cell line U937. Cell Biochem Funct 2009;27:503–15.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Fukuhara H,
    2. Inoue K,
    3. Kurabayashi A,
    4. Furihata M,
    5. Fujita H,
    6. Utsumi K,
    7. et al.
    The inhibition of ferrochelatase enhances 5-aminolevulinic acid-based photodynamic action for prostate cancer. Photodiagnosis Photodyn Ther 2013;10:399–409.
    OpenUrlCrossRefPubMed
  16. 16.↵
    1. Inoue K,
    2. Fukuhara H,
    3. Kurabayashi A,
    4. Furihata M,
    5. Tsuda M,
    6. Nagakawa K,
    7. et al.
    Photodynamic therapy involves an antiangiogenic mechanism and is enhanced by ferrochelatase inhibitor in urothelial carcinoma. Cancer Sci 2013;104:765–72.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Inoue K,
    2. Karashima T,
    3. Kamada M,
    4. Shuin T,
    5. Kurabayashi A,
    6. Furihata M,
    7. et al.
    Regulation of 5-aminolevulinic acid-mediated protoporphyrin IX accumulation in human urothelial carcinomas. Pathobiology 2009;76:303–14.
    OpenUrlCrossRefPubMed
  18. 18.↵
    1. Kobuchi H,
    2. Moriya K,
    3. Ogino T,
    4. Fujita H,
    5. Inoue K,
    6. Shuin T,
    7. et al.
    Mitochondrial localization of ABC transporter ABCG2 and its function in 5-aminolevulinic acid-mediated protoporphyrin IX accumulation. PloS One 2012;7:e50082.
    OpenUrlCrossRefPubMed
  19. 19.↵
    1. Ogino T,
    2. Kobuchi H,
    3. Munetomo K,
    4. Fujita H,
    5. Yamamoto M,
    6. Utsumi T,
    7. et al.
    Serum-dependent export of protoporphyrin IX by ATP-binding cassette transporter G2 in T24 cells. Mol Cell Biochem 2011;358:297–307.
    OpenUrlCrossRefPubMed
  20. 20.↵
    1. Vail JT Jr.
    . Porphyria cutanea tarda and estrogens. JAMA 1967;201:671–4.
    OpenUrlCrossRefPubMed
  21. 21.↵
    1. Gibson SL,
    2. Anderson LT,
    3. Havens JJ,
    4. Hilf R
    . Effect of estrogenic perturbations on delta-aminolevulinic acid-induced porphobilinogen deaminase and protoporphyrin IX levels in rat Harderian glands, liver, and R3230AC tumors. Biochem Pharmacol 1999;58:1821–9.
    OpenUrlCrossRefPubMed
  22. 22.↵
    1. Kuiper GG,
    2. Lemmen JG,
    3. Carlsson B,
    4. Corton JC,
    5. Safe SH,
    6. van der Saag PT,
    7. et al.
    Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology 1998;139:4252–63.
    OpenUrlCrossRefPubMed
  23. 23.↵
    1. Ming LG,
    2. Chen KM,
    3. Xian CJ
    . Functions and action mechanisms of flavonoids genistein and icariin in regulating bone remodeling. J Cell Physiol 2013;228:513–21.
    OpenUrlCrossRefPubMed
  24. 24.↵
    1. Prossnitz ER,
    2. Barton M
    . The G-protein-coupled estrogen receptor GPER in health and disease. Nat Rev Endocrinol 2011;7:715–26.
    OpenUrlCrossRefPubMed
  25. 25.↵
    1. Imai Y,
    2. Tsukahara S,
    3. Asada S,
    4. Sugimoto Y
    . Phytoestrogens/flavonoids reverse breast cancer resistance protein/ABCG2-mediated multidrug resistance. Cancer Res 2004;64:4346–52.
    OpenUrlAbstract/FREE Full Text
  26. 26.↵
    1. Beral V
    . Breast cancer and hormone-replacement therapy in the Million Women Study. Lancet 2003;362:419–27.
    OpenUrlCrossRefPubMed
  27. 27.↵
    1. Beral V,
    2. Bull D,
    3. Green J,
    4. Reeves G
    . Ovarian cancer and hormone replacement therapy in the Million Women Study. Lancet 2007;369:1703–10.
    OpenUrlCrossRefPubMed
  28. 28.↵
    1. Lucki NC,
    2. Sewer MB
    . Genistein stimulates MCF-7 breast cancer cell growth by inducing acid ceramidase (ASAH1) gene expression. J Biol Chem 2011;286:19399–409.
    OpenUrlAbstract/FREE Full Text
  29. 29.↵
    1. Berg K,
    2. Anholt H,
    3. Bech O,
    4. Moan J
    . The influence of iron chelators on the accumulation of protoporphyrin IX in 5-aminolaevulinic acid-treated cells. Br J Cancer 1996;74:688–97.
    OpenUrlCrossRefPubMed
  30. 30.↵
    1. Lin F,
    2. Geiger PG,
    3. Korytowski W,
    4. Girotti AW
    . Protoporphyrin IX-sensitized photoinactivation of 5-aminolevulinate-treated leukemia cells: effects of exogenous iron. Photochem Photobiol 1999;69:375–81.
    OpenUrlCrossRefPubMed
  31. 31.↵
    1. Tan WC,
    2. Krasner N,
    3. O'Toole P,
    4. Lombard M
    . Enhancement of photodynamic therapy in gastric cancer cells by removal of iron. Gut 1997;41:14–8.
    OpenUrlAbstract/FREE Full Text
  32. 32.↵
    1. Mahmoud AM,
    2. Yang W,
    3. Bosland MC
    . Soy isoflavones and prostate cancer: a review of molecular mechanisms. J Steroid Biochem Mol Biol 2014;140:116–32.
    OpenUrlCrossRefPubMed
  33. 33.↵
    1. Hershberger PA,
    2. Stabile LP,
    3. Kanterewicz B,
    4. Rothstein ME,
    5. Gubish CT,
    6. Land S,
    7. et al.
    Estrogen receptor beta (ERbeta) subtype-specific ligands increase transcription, p44/p42 mitogen activated protein kinase (MAPK) activation and growth in human non-small cell lung cancer cells. J Steroid Biochem Mol Biol 2009;116:102–9.
    OpenUrlCrossRefPubMed
  34. 34.↵
    1. Verma MK,
    2. Miki Y,
    3. Abe K,
    4. Niikawa H,
    5. Sasano H
    . Cytoplasmic estrogen receptor beta as a potential marker in human non-small cell lung carcinoma. Expert Opin Ther Targets 2012;16:S91–102.
    OpenUrl
  35. 35.↵
    1. Shen L,
    2. Li Z,
    3. Shen S,
    4. Niu X,
    5. Yu Y,
    6. Li Z,
    7. et al.
    The synergistic effect of EGFR tyrosine kinase inhibitor gefitinib in combination with aromatase inhibitor anastrozole in non-small cell lung cancer cell lines. Lung Cancer 2012;78:193–200.
    OpenUrlCrossRefPubMed
  36. 36.↵
    1. Tang H,
    2. Liao Y,
    3. Chen G,
    4. Xu L,
    5. Zhang C,
    6. Ju S,
    7. et al.
    Estrogen upregulates the IGF-1 signaling pathway in lung cancer through estrogen receptor-beta. Med Oncol 2012;29:2640–8.
    OpenUrlCrossRefPubMed
  37. 37.↵
    1. Elder GH
    . Porphyria cutanea tarda. SemLiver Dis 1998;18:67–75.
    OpenUrlCrossRef
  38. 38.↵
    1. Urbanek RW,
    2. Cohen DJ
    . Porphyria cutanea tarda: pregnancy versus estrogen effect. J Am Acad Dermatol 1994;31:390–2.
    OpenUrlCrossRefPubMed
  39. 39.↵
    1. Phillips JD,
    2. Jackson LK,
    3. Bunting M,
    4. Franklin MR,
    5. Thomas KR,
    6. Levy JE,
    7. et al.
    A mouse model of familial porphyria cutanea tarda. Proc Natl Acad Sci USA 2001;98:259–64.
    OpenUrlAbstract/FREE Full Text
  40. 40.↵
    1. Shiau RJ,
    2. Chen KY,
    3. Wen YD,
    4. Chuang CH,
    5. Yeh SL
    . Genistein and beta-carotene enhance the growth-inhibitory effect of trichostatin A in A549 cells. Eur J Nutr 2010;49:19–25.
    OpenUrlCrossRefPubMed
  41. 41.↵
    1. Wu TC,
    2. Yang YC,
    3. Huang PR,
    4. Wen YD,
    5. Yeh SL
    . Genistein enhances the effect of trichostatin A on inhibition of A549 cell growth by increasing expression of TNF receptor-1. Toxicol Appl Pharmacol 2012;262:247–54.
    OpenUrlCrossRefPubMed
  42. 42.↵
    1. Hu M,
    2. Krausz K,
    3. Chen J,
    4. Ge X,
    5. Li J,
    6. Gelboin HL
    et al. Identification of CYP1A2 as the main isoform for the phase I hydroxylated metabolism of genistein and a prodrug converting enzyme of methylated isoflavones. Drug Metab Dispos 2003;31:924–31.
    OpenUrlAbstract/FREE Full Text
  43. 43.↵
    1. Kulling SE,
    2. Honig DM,
    3. Metzler M
    . Oxidative metabolism of the soy isoflavones daidzein and genistein in humans in vitro and in vivo. J Agr Food Chem 2001;49:3024–33.
    OpenUrlCrossRef
  44. 44.↵
    1. Cho K,
    2. Wang X,
    3. Nie S,
    4. Chen ZG,
    5. Shin DM.
    Therapeutic nanoparticles for drug delivery in cancer. Clin Cancer Res 2008;14:1310–6.
    OpenUrlAbstract/FREE Full Text
  45. 45.↵
    1. Wei H,
    2. Wei L,
    3. Frenkel K,
    4. Bowen R,
    5. Barnes S
    . Inhibition of tumor promoter-induced hydrogen peroxide formation in vitro and in vivo by genistein. Nutr Cancer 1993;20:1–12.
    OpenUrlCrossRefPubMed
  46. 46.↵
    1. Borrás C,
    2. Gambini J,
    3. Gómez-Cabrera MC,
    4. Sastre J,
    5. Pallardó FV,
    6. Mann GE
    et al. Genistein, a soy isoflavone, up-regulates expression of antioxidant genes: involvement of estrogen receptors, ERK1/2, and NFkappaB. FASEB J 2006;20:2136–8.
    OpenUrlAbstract/FREE Full Text
View Abstract
Back to top
View this article with LENS

Open full page PDF
Article Alerts
Email Article
Citation Tools
Phytoestrogen Suppresses Efflux of the Diagnostic Marker Protoporphyrin IX in Lung Carcinoma
Hirofumi Fujita, Keisuke Nagakawa, Hirotsugu Kobuchi, Tetsuya Ogino, Yoichi Kondo, Keiji Inoue, Taro Shuin, Toshihiko Utsumi, Kozo Utsumi, Junzo Sasaki and Hideyo Ohuchi
Cancer Res April 1 2016 (76) (7) 1837-1846; DOI: 10.1158/0008-5472.CAN-15-1484
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Advertisement