Enhancement of Folate Receptor α Expression in Tumor Cells Through the Glucocorticoid Receptor: A Promising Means to Improved Tumor Detection and Targeting

In recent years, the glycosyl-phosphatidylinositol–anchored folate receptor (FR) type α has served as a model target for tumor-specific delivery of a broad range of pharmacologic and immunologic experimental therapies, for the following reasons: (a) FR-α is expressed in several cancers such as non–mucinous adenocarcinomas of the ovary and uterus, malignant pleural mesothelioma, testicular choriocarcinoma, ependymal brain tumors, nonfunctioning pituitary adenoma, and variably in breast, colon, and renal carcinoma (reviewed in ref. 1); (b) FR-α expression in proliferating normal tissues (reviewed in ref. 1) is restricted to the luminal surface of certain epithelial cells, where it is inaccessible to the circulation, whereas the receptor expressed in tumors is accessible via the circulation. FR-α–targeted low molecular weight agents that may filter through the glomerulus and bind to the receptor in proximal kidney tubules seem to be transcytosed and reabsorbed, avoiding nephrotoxicity (2); (c) other FR isoforms are either expressed in a nonfunctional manner in mature hematopoietic cells (FR-β; refs. 3, 4) or poorly expressed and constitutively secreted (FR-γ/γ′; refs. 5, 6); and (d) FR-α quantitatively recycles between the cell surface and intracellular compartments (reviewed in ref. 7), effectively internalizing receptor-bound folate/antifolate compounds and folate conjugates (8, 9). Various FR-α–targeted therapeutics (reviewed in refs. 10–17) and imaging agents (reviewed in ref. 18) have shown promise in preclinical models and in early clinical trials. These agents include radiopharmaceutical and cytotoxic conjugates of folate including prodrugs, prodrug-activating enzymes, nanoparticles, and liposomal drugs as well as potent novel antifolates that are dependent on FR-α for cellular uptake. The FR-α–targeted immunologic therapies include bifunctional antibodies and antibody-interleukin chimeras, peptide and DNA vaccines, and more innovative agents such as dual-specific T cells and folate-hapten conjugates. A portion of the FR-α expressed on the cell surface is released in a soluble form by the combined action of a membrane-associated protease and glycosyl-phosphatidylinositol–specific phospholipase (19–22). Soluble FR-α is low or undetected in normal human sera, and therefore, the protein shed into the circulation is a potential serum marker for FR-α–positive tumors (23).

Even though major subtypes of malignant tissues show consistent patterns of FR-α expression, there is a considerable variability and heterogeneity in the tumor expression levels of the receptor covering a range of almost two orders of magnitude (24, 25). The successful experimental FR-targeted therapies in animal models have used xenografts of human tumor cells (e.g., KB cells) that express the receptor uniformly and at levels closer to the high end of this range, underscoring the importance of developing molecular methods of up-regulating the FR gene selectively in malignant cells. Increased FR-α expression by the tumors may be expected to enhance the efficacy of the receptor-targeted therapies and whole-body imaging, and increase the levels of soluble FR-α for early detection as a diagnostic serum marker.

The FR-α gene has seven exons and six introns with multiple transcripts resulting from the use of alternative promoters as well as alternative splicing involving exons 1 to 4 (26, 27). The FR-α gene contains two promoters, named P1 and P4, located upstream of exons 1 and 4, respectively. Transcripts generated by both promoters encode identical proteins, but the P4 promoter activity seems to be predominant in malignant cells (28) and further, P1 promoter-driven transcripts seem to be translated several-fold less efficiently than the P4 promoter-driven transcript (29). The basal TATA-less P4 promoter activity is initiated by a cluster of three G/C-rich sequences that are noncanonical Sp1 binding sites, each of which contributes to promoter activity (27).

We have previously reported that the FR-α gene is directly and negatively regulated by the estrogen receptor (28). Here, we report that the FR-α gene is indirectly and positively regulated at the transcriptional (P4 promoter) level by the glucocorticoid receptor (GR) agonist, dexamethasone, and that this profound regulation is further potentiated by inhibiting histone deacetylase (HDAC). The selectivity of this regulation for FR-α–positive tissues, the innocuous nature of the modulating agents and the ubiquitous expression of GR present a potential means of greatly improving the effectiveness of all available FR-α–targeted therapeutic and diagnostic strategies by the inclusion of GR modulators. The findings also illustrate the potential utility of general transcription modulators in optimizing the expression of genes encoding marker proteins and drug targets that are selectively expressed in tumor tissues. These considerations provided the impetus for the present study of the nature and mechanism of GR regulation of FR-α in vitro and for examining the effect of GR modulation on tumor and serum levels of the protein in vivo.

Chemicals and reagents. DMEM, RPMI, and penicillin/streptomycin/l-glutamine stock mix were purchased from Life Technologies, Inc. (Carlsbad, CA). Fetal bovine serum (FBS) was purchased from Irvine Scientific (Santa Ana, CA). FuGENE 6 was purchased from Roche Diagnostics (Indianapolis, IN), luciferase assay reagents from Promega (Madison, WI) dexamethasone from Sigma (St. Louis, MO), dexamethasone and placebo pellets from Innovative Research of America (Sarasota, FL), trichostatin A, valproic acid, and cycloheximide from Sigma. Affinity-purified rabbit anti-human Sp1, anti-human Sp3, anti-human Sp4 antibodies, and rabbit polyclonal IgG against GR were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Mouse anti-α tubulin clone B-5-1-2 antibody was from Sigma. Vent DNA polymerase was purchased from New England Biolabs (Beverly, MA), and custom oligonucleotide primers from Life Technologies. The reagents for real-time reverse transcription-PCR were from Applied Biosystems (Branchburg, NJ).

DNA constructs and expression plasmids. Construct design made use of either natural restriction sites or restriction sites created by the addition of appropriate restriction sites to upstream and downstream PCR primers. The PCR products were first digested at both ends with the appropriate restriction enzymes and cloned into the PGL3-basic plasmid (Promega) or subcloned into the FR-α-promoter construct (−3,394 to +33 nt, relative to the transcription initiation site at +1 nt) in the PGL3 basic plasmid. The FR-α −3,394 to −47 nt/SV40(GC)₆ and the FR-α-3,394 to −32 nt/SV40(INR) constructs are described elsewhere (28). The 5′ deletion constructs of the FR-α promoter, i.e., −272 to +33 nt, −116 to +33 nt, and −49 to +33 nt were all constructed by PCR using the appropriate primers and subcloned at MluI (upstream) and XhoI (downstream) sites in the pGL3 basic plasmid. In addition the G/C-rich sequence, −49 to −35 nt within the FR-α promoter (−49 to +33 nt)-luciferase construct was replaced by a TATA-box element (5′-AATAATTAA-3′) using PCR. The recombinant plasmids were amplified in E. coli strain XL1Blue and purified using the Qiagen plasmid kit (Qiagen, Chatsworth, CA). The entire cloned DNA sequence was verified by sequencing.

The expression plasmids for hSRC-1, hSRC-2, and hpCAF, the corresponding vector plasmid pCR 3.1 and the GRE₂e1b promoter-luciferase plasmid were provided by Dr. Brian Rowan (Medical College of Ohio, OH). The expression plasmids for Sp1 and Sp3 were provided by Dr. Sumudra Periyasamy (Medical College of Ohio, OH). The expression plasmid for Sp4 was provided by Dr. Guntram Suske (Institut for Molekularbiologie und Tumorforschung Philipps-Universitat Marburg).

Cell culture and transfection. All of the cell lines were purchased from American Type Culture Collection (Rockville, MD) except for NB4 and KCL-22 cells, which were provided by Dr. Philip Koeffler (University of California, Los Angeles, CA) and Ishikawa cells provided by Dr. Brian Rowan (Medical College of Ohio, OH). Cells growing as monolayers were grown in 10 cm tissue culture plates at 37°C in 5% CO₂ in the appropriate cell culture media supplemented with FBS (10%), 100 units/mL penicillin, 100 μg/mL streptomycin, and 2 mmol/L l-glutamine. Caki-1, HeLa, MG63, MCF-7, JEG, JAR, Ishikawa, SKOV-3, and SVG cells were routinely cultured in DMEM. NB4, KCL-22, K562, and KG-1 cells were grown in RPMI 1640. For treatment with various agents (dexamethasone, valproic acid, and trichostatin A) and for transfection, cells were grown in phenol red–free media supplemented with charcoal-stripped FBS (5% v/v), penicillin (100 units/mL), streptomycin (100 mg/mL), l-glutamine (2 mmol/L), insulin (2 μg/mL), and transferrin (40 μg/mL).

Transfections with various constructs were carried out in six-well plates (Corning, New York, NY) using FuGENE 6 (Roche Diagnostics), according to the manufacturer's suggested protocol. The amount of plasmid DNAs used for the transfections varied as indicated in the appropriate figure legends. Uniformity in transfection efficiencies was ascertained from measurements of β-galactosidase activity after cotransfection with an expression plasmid for this enzyme.

Preparation of cell lysates and luciferase assay. Cells in each well of a six-well tissue culture plate were washed once with PBS (pH 7.5; 2 mmol/L KH₂PO₄, 2.7 mmol/L KCl, 10 mmol/L Na₂HPO₄, 137 mmol/L NaCl) and lysed in 400 μL of reporter lysis buffer provided with the luciferase assay system (Promega). The samples were centrifuged at 12,000 × g for 2 minutes at room temperature. The supernatant was assayed for luciferase activity in a luminometer (Lumat LB9501, Berthold, Wildbad, Germany) using the luciferase substrate from Promega.

Real-time reverse transcription-PCR analysis. Total RNA for real-time reverse transcription-PCR from various cell lines was prepared using the RNeasy Mini kit purchased from Qiagen. Real-time reverse transcription-PCR was used to measure endogenous mRNAs for FR-α as well as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same samples. The reverse transcription step was carried out following standard procedures. Essentially, 200 ng of total RNA was mixed with random hexamer primers (5 × 10⁻⁴ absorbance units/μL), RNase inhibitor (1 unit/μL), Moloney murine leukemia virus reverse transcriptase (5 units/μL), and deoxynucleoside triphosphates (1.0 mmol/L each) in reverse transcriptase buffer [50 mmol/L potassium chloride and 10 mmol/L Tris-HCl (pH 8.3)]. The 10 μL reaction mixture was first incubated at 25°C for 10 minutes, then at 42°C for 15 minutes, and finally at 99°C for 6.5 minutes. The subsequent real-time PCR step for FR-α was carried out in the presence of 12.5 μL of PCR Mastermix (Applied Biosystems), 0.5 μL each of the forward primer (AAGTGCCGAGTGGGAGCT) and reverse primer (CATTGCACAGAACAGTGGGTG), and 0.5 μL of the TaqMan probe (6FAM-CCTGCCAACCTTTCCATTTCTACTTCCCC-TAMRA). The primers and the TaqMan probe for the control GAPDH gene were purchased from Applied Biosystems. The PCR conditions were 2 minutes at 50°C, then 10 minutes at 95°C, followed by 40 cycles of 15 seconds each at 95°C and finally 1 minute at 60°C. Fluorescence data generated were monitored and recorded by the Gene Amp 5700 sequence detection system (Applied Biosystems). All samples were set-up in triplicate and normalized to GAPDH values.

Measurement of cell surface binding of pteroyl lysine-fluorescein. The fluorescent folate analogue, pteroyl lysine-fluorescein, was kindly provided by Dr. John Hynes. HeLa cells grown in six-well plates and subjected to appropriate treatments were washed with PBS, detached from the plate by treatment with 2 mmol/L EDTA and resuspended in cold PBS. The cells were then washed briefly with isotonic acid buffer [10 mmol/L sodium acetate buffer (pH 3.5)/150 mmol/L NaCl] to remove endogenous bound folate, washed again in PBS and resuspended in PBS containing pteroyl lysine-fluorescein (10 nmol/L) and incubated on ice for 30 minutes with intermittent gentle agitation. The fluorescence on the surface of cells due to pteroyl lysine-fluorescein binding was measured in an EPICS Elite cytometer (Beckman Coulter, Fullerton, CA). Background fluorescence on the cell surface due to nonspecific binding of pteroyl lysine-fluorescein was determined by preincubating the cells with unlabeled folic acid (1 μmol/L) for 10 minutes before the addition of pteroyl lysine-fluorescein.

[³H]Folic acid binding assay for serum folate receptor. Twenty microliters of mouse serum was diluted into 0.5 mL of assay buffer [10 mmol/L sodium phosphate buffer (pH 7.5)/150 mmol/L NaCl/1% Triton X-100] in a 1.5 mL Eppendorf tube. To each assay tube, 2 pmol of [³H]folic acid (Moraveck, Brea, CA) was added and after incubation for 1 hour at 37°C, the protein-bound [³H]folic acid was measured by a charcoal-binding method as described (6). Nonspecific binding of [³H]folic acid was determined by carrying out the assay as above but after preincubating the diluted serum in the assay tube for 10 minutes with a 100-fold excess of unlabeled folic acid (200 pmol).

Phosphatidylinositol-specific phospholipase C treatment. HeLa cells grown in six-well plates and subjected to the appropriate treatments were treated with phosphatidylinositol-specific phospholipase C (0.1 units/mL) by adding the enzyme directly into the culture medium followed by incubation for 3 hours at 37°C. The cell lysates, prepared by lysis in PBS containing 1% Triton X-100 were subjected to Western blot analysis.

Preparation of nuclear extracts. HeLa cells subjected to the appropriate treatments were washed twice with PBS, scraped off the six-well plates, snap-frozen in liquid nitrogen, and stored at −80°C until the next step. Nuclear extracts were prepared as described (28), except that the cytoplasmic fractions were retained after lysis of cells for subsequent Western blot analysis. The nuclear extracts were desalted using G-25 Sephadex columns (Roche Diagnostics) following the supplier's protocol. The protein concentrations were determined by the Bradford assay (Bio-Rad, Hercules, CA).

Western blot analysis. Protein samples (10-20 μg) were resolved by electrophoresis on 8% SDS-PAGE gels and electrophoretically transferred to nitrocellulose filters. The blots were probed with the appropriate primary rabbit antibodies followed by goat anti-rabbit IgG conjugated to horseradish peroxidase and visualized using the enhanced chemiluminescence method. The same membrane was then similarly reprobed with a primary mouse anti-α tubulin antibody and secondary goat anti-mouse IgG conjugated to horseradish peroxidase and also subjected to Coomassie blue staining to ensure uniform sample loading.

Murine tumor xenograft model. Fox chase out-bred SCID female mice (29-35 days old) purchased from Charles River Laboratories were maintained under controlled conditions and fed with folate-free rodent chow ad libitum during the course of the experiments. After a period of acclimation, the mice were injected with 5 × 10⁶ HeLa cells s.c. into the interscapular region. Dexamethasone pellets (0.001 mg/pellet for a 21-day release schedule) or placebo pellets were implanted s.c. when the tumor became palpable and grew to a diameter of approximately 0.5 cm. Five days after implanting the pellets, the mice were euthanized and the blood and tumor tissue collected. The tumors were snap-frozen in liquid nitrogen and stored at −80°C. The frozen tumor tissue was ground using mortar and pestle, lysed in PBS containing 1% Triton X-100, and centrifuged for separation of insoluble cell debris. The supernatant was used for Western blot analysis.

Effect of dexamethasone on FR-α expression in HeLa cells. Treatment of HeLa cells with dexamethasone (100 nmol/L) resulted in a progressive increase in the expression of both endogenous FR-α mRNA, measured by real-time PCR and FR-α protein, detected by Western blot using a FR-specific rabbit antiserum (Fig. 1A). This induction of FR-α began between 24 and 48 hours, and reached up to 7-fold elevation at 96 hours (Fig. 1A). In HeLa cells transfected with a full-length FR-α promoter-luciferase reporter construct (−3,394 to +33 nt), dexamethasone caused a dose-dependent increase in the promoter activity, reaching optimal activity between 5 and 50 nmol/L dexamethasone (Fig. 1B) and a corresponding dexamethasone dose-dependent increase in endogenous FR-α expression (Fig. 1B). These results provide evidence for positive regulation of FR-α by dexamethasone at the transcriptional level.

The induction of FR-α in HeLa cells by dexamethasone did not reflect a global increase in gene expression, because under these conditions, the expression level of the GAPDH gene (Fig. 1A) as well as tubulin and Sp family proteins (Figs. 1A and 5B, discussed in a later section) were unaltered. The typical plasma membrane localization and glycosyl-phosphatidylinositol membrane anchor attachment known for FR-α was confirmed for the receptor synthesized de novo following dexamethasone treatment, because as seen with the Western blot, the dexamethasone-induced FR was quantitatively cleaved from the cell surface upon treatment with phosphatidylinositol-specific phospholipase C, which is a diagnostic characteristic of proteins with a glycosyl-phosphatidylinositol plasma membrane anchor (Fig. 1C). Furthermore, the dexamethasone-induced FR-α protein retained its ability to bind ligand on the cell surface, evident from an increase in the binding of the fluorescent folate analogue, pteroyl lysine-fluorescein on the surface of the treated cells (Fig. 1D). Thus, the subcellular localization and function of FR-α was unaltered by dexamethasone induction.

GR ligand-specificity of FR-α induction. RU-486, a specific antagonist of GR that competes with dexamethasone for binding to GR, inhibited the induction of FR-α promoter-luciferase reporter in transfected HeLa cells in a dose-dependent manner (Fig. 2A). RU-486 similarly inhibited dexamethasone activation of the control GRE₂e1b promoter-luciferase reporter construct in transfected HeLa cells (Fig. 2B). The GRE₂e1b promoter contains a glucocorticoid response element (GRE) and is a classical target of dexamethasone activation through GR. Under similar conditions, the dose response of inhibition of the FR-α promoter activity by RU-486 paralleled that for the GRE₂e1b promoter, suggesting that the regulation of the FR-α promoter by dexamethasone is, at some level, mediated by GR.

Response time and reversibility of dexamethasone induction of the FR-α promoter. HeLa cells were transiently transfected with either GRE₂e1b promoter-luciferase or FR-α promoter-luciferase and treatment of the cells with either dexamethasone or vehicle begun at 12 hours post-transfection (Fig. 3). In the transiently transfected cells, close to maximal activation of the GRE₂e1b promoter-luciferase by dexamethasone occurred at 3 hours, reached the maximum value at 6 hours and declined between 24 and 48 hours (Fig. 3A). In contrast, dexamethasone activation of transiently transfected FR-α promoter-luciferase was relatively low at 3 hours and progressed gradually, reaching its maximum value at 24 hours and was sustained up to 48 hours (Fig. 3B). Furthermore, when dexamethasone was withdrawn at 6, 12, or 24 hours, the activity of the GRE₂e1b promoter measured at 48 hours was greatly reduced compared with the values measured at 6, 12, and 24 hours, respectively (Fig. 3A). In contrast, after withdrawal of dexamethasone at 6, 12, or 24 hours, the activity of the FR-α promoter further increased as seen at 48 hours (Fig. 3B). This observation explains why contrary to the GRE₂e1b promoter, the activity of the FR-α promoter was sustained in the later stage of transient transfection (Fig. 3A and B). This delayed activation of the FR-α promoter by dexamethasone indicates that the dexamethasone response is likely mediated indirectly through a product(s) of dexamethasone/GR action on an upstream target gene(s) of dexamethasone and that the mode of action of dexamethasone on the FR-α promoter is thus likely fundamentally different from its activation of a GRE-driven promoter.

Effect of cycloheximide on dexamethasone induction of the FR-α promoter. The possibility that the action of dexamethasone on the FR-α promoter requires intermediate synthesis of a protein factor(s) was tested using cycloheximide to inhibit de novo protein synthesis during the early stage (0-12 hours) of dexamethasone treatment (Fig. 3C). The delayed induction of FR-α promoter activity observed at 72 hours after only a 12-hour treatment with dexamethasone was abrogated when cycloheximide was included during the dexamethasone treatment (Fig. 3C). This result indicates that in dexamethasone induction of the FR-α promoter, an early action of dexamethasone is to induce de novo synthesis of some other protein(s).

Effect of coactivators on FR-α promoter activity and its induction by dexamethasone. The effect of the nuclear receptor/GR coactivators, SRC-1, SRC-2, and pCAF on promoter activity as well as its activation by dexamethasone was measured in HeLa cells cotransfected with expression plasmids for the individual coactivators and FR-α promoter-luciferase (Table 1). Each of the coactivators enhanced the basal FR-α promoter activity. However, each of the coactivators also potentiated dexamethasone induction of the FR-α promoter. This result lends further support to GR mediation of the dexamethasone effect on FR-α gene expression and the view that this regulation, albeit indirect, is transcriptional.

Identification of the target site of dexamethasone action in the FR-α promoter. The FR-α promoter-luciferase reporter construct used in the above studies included the FR-α gene sequence, −3,394 to +33 nt, spanning both the P1 and the P4 promoters. 5′ deleted versions of this promoter construct, i.e., the −272 to +33 nt and the −116 to +33 nt fragments of the promoter, retained the dexamethasone responsiveness of the full-length construct in transfected HeLa cells (Fig. 4A). The time course of the dexamethasone response was also unaltered for the truncated promoter fragments (Fig. 4A). The only functional cis elements known to occur between the initiator sequence and −116 nt are the G/C-rich Sp1 binding sites of the P4 promoter, indicated in Fig. 4B. A further 5′ deletion of FR-α promoter luciferase in which all of the promoter sequence upstream of the most proximal Sp1 element was deleted retained the dexamethasone response (Fig. 4C). Because the single Sp1 element in the FR-α (−49 to +33 nt) construct is necessary for basal promoter activity (27), a possible role for this G/C-rich element in mediating the dexamethasone effect was tested by replacing this sequence (−49 to −35 nt) with a TATA-box element (AATAATTAA) to retain basal promoter activity (Fig. 4C). The chimeric promoter was unresponsive to dexamethasone treatment (Fig. 4C), implicating the Sp1 element as a mediator of the dexamethasone effect.

To determine whether another Sp1-dependent promoter, similar to the FR-α promoter, would respond to dexamethasone in a similar manner as the FR-α P4 promoter, the effect of dexamethasone was tested on the Sp1-dependent SV40 promoter-luciferase reporter. In transfected HeLa cells dexamethasone enhanced the activity of the SV40 promoter, with a time course that was similar to that for the FR-α promoter (Fig. 4D). It may be noted that the G/C-rich region of the SV40 promoter is a stronger Sp1 element than that of the FR-α P4 promoter because it contains six repeat Sp1 elements. To determine the relative roles of the initiator (and the flanking) region and the Sp1 elements in the dexamethasone response of the P4 promoter, either the P4 initiator region (−28 to +33 nt) or the entire G/C-rich region of the P4 promoter in the full length FR-α promoter-luciferase construct was replaced by the corresponding regions of the SV40 promoter (Fig. 4D). Both the chimeric promoter constructs were responsive to dexamethasone with a time course similar to that of the FR-α promoter; however, the magnitude of the dexamethasone response was much greater for the FR-α promoter chimera containing the G/C-rich region of the SV40 promoter (Fig. 4D). This suggests that whereas a G/C-rich sequence element mediates and may determine the magnitude of the delayed dexamethasone response of a promoter, for optimal response to occur, there is a preferred initiator context.

The action of Sp family proteins on the FR-α promoter and the effect of dexamethasone on their expression levels. A well-known mechanism of gene regulation through G/C-rich cis elements involves changes in differential expression and transcriptional activities of their cognate trans factors, i.e., Sp family proteins. To test this possibility, the action of major Sp family members including Sp1, Sp3, and Sp4 on the FR-α promoter activity was tested by cotransfection of HeLa cells with FR-α promoter-luciferase and expression plasmids for the Sp proteins, individually and in combination. All of the Sp proteins were equipotent activators of the FR-α promoter (Fig. 5A). Furthermore, dexamethasone treatment of HeLa cells (up to 96 hours) did not result in any obvious substantive changes in the expression levels of endogenous Sp1, Sp3, or Sp4 or their apparent molecular weights, under conditions in which endogenous FR-α was up-regulated (Fig. 5B). These results exclude changes in the relative expression levels or phosphorylation levels of Sp1, Sp3, or Sp4 as a mechanism mediating the dexamethasone effect on the FR-α gene and suggest that dexamethasone regulates the interaction(s) of some other transcription factor(s) with the core transcription initiation complex of the P4 promoter.

The action of inhibitors of histone deacetylase on dexamethasone induction of FR-α gene expression. Because the transcriptional activity of nuclear receptors entails modulation of histone acetylation, it was of interest to examine the effects of HDAC inhibitors on dexamethasone induction of FR-α gene transcription. The well-tolerated drug valproic acid and the well-characterized laboratory reagent, trichostatin A, were chosen as the HDAC inhibitors for these experiments. In HeLa cells transfected with FR-α promoter-luciferase, both valproic acid (Fig. 6A) and trichostatin A (Fig. 6B) independently increased the promoter activity to some extent within their pharmacologic dose ranges but they both greatly potentiated dexamethasone induction of the FR-α promoter. Valproic acid also potentiated dexamethasone induction of the endogenous FR-α in HeLa cells, in a dose-dependent manner (Fig. 6C). Finally, the potentiation of the dexamethasone induction of the transfected FR-α promoter-luciferase in HeLa cells by valproic acid occurred both during the early (0-24 hours) and later (24-72 hours) stages of dexamethasone treatment (Fig. 6D). Under the conditions of the above treatments, the HDAC inhibitors did not affect the viability or the growth of HeLa cells (data not shown).

Effect of dexamethasone treatment and histone deacetylase inhibition on endogenous FR-α gene expression in FR-α–positive versus FR-α–negative cell lines. In order to test whether dexamethasone increased FR-α gene expression in other FR-α–positive cell lines and to examine whether dexamethasone could alter the tissue expression pattern of FR-α by producing de novo expression of the receptor in FR-α–negative cells, a variety of cell types were treated with dexamethasone, trichostatin A, or a combination of dexamethasone and trichostatin A. Cells in which FR-α mRNA was determined by real-time reverse transcription-PCR to be <1/1,000 of that in HeLa cells and in which the FR-α protein was undetectable by Western blot were considered to be FR-α–negative. In human hematopoietic cells (KG-1, Kcl-22, K-562, and NB-4), fibroblasts (MG-63 and SVG), and epithelial (Caki-1) cell lines that were FR-α–negative, there was no detectable increase in the receptor mRNA expression upon dexamethasone/trichostatin A treatments (Table 2); however, in JAR, Ishikawa, and SKOV-3 cells that are FR-α–positive, dexamethasone, alone or in combination with trichostatin A, increased FR-α expression (Table 2).

Effect of dexamethasone/trichostatin A on GR expression. GR is known to be down-regulated in cells treated with dexamethasone. The effect of dexamethasone/trichostatin A on GR expression in HeLa cells was tested in order to explore the possibility that modulation of GR expression plays a role in the potentiation of dexamethasone induction of the FR-α promoter by HDAC inhibition (Fig. 7). The Western blot data in Fig. 7 shows that over a period of 96 hours of dexamethasone treatment, GR was progressively down-regulated by dexamethasone, alone, as well as by dexamethasone in the presence of trichostatin A. Although trichostatin A by itself did not alter the GR level, it did seem to decrease the extent of down-regulation of GR by dexamethasone. However, this did not seem to be a significant factor in the synergy produced by trichostatin A at least in the early stage (up to 48 hours) because the GR levels were comparable between the two treatments up to 48 hours.

Up-regulation of tumor and serum FR-α by dexamethasone in a murine tumor xenograft model. A murine tumor xenograft model was used to test whether the in vitro observations of FR-α induction by dexamethasone would extend to the regulation of the FR-α gene in the physiologic milieu. In Fig. 8A, two groups of three SCID female mice bearing s.c. HeLa cell tumors (∼0.5 cm diameter) were tested. Either low-dose slow-release dexamethasone pellets (to achieve a circulating concentration of 0.24 μmol/L dexamethasone) or placebo pellets were implanted s.c. in the mice for a duration of 5 days before sacrificing the mice to harvest the tumors. As expected, the dexamethasone treatment did not cause a significant difference between the treated and placebo groups in terms of body weight and activity (data not shown). Dexamethasone treatment caused a substantial increase in FR-α protein in the tumors as seen by Western blot analysis of the tumor cell lysate (Fig. 8A).

In Fig. 8B, the effect of dexamethasone on the level of soluble FR in the serum was tested in the mouse HeLa cell tumor xenograft model and compared with control mice that did not bear the tumor. Groups of five mice were used in this experiment and serum FR was estimated by using [³H]folic acid binding assay. S.c. inoculation of HeLa cells and treatment with dexamethasone or placebo pellets were carried out as described above for Fig. 8B and at the end of the treatment, blood samples were collected from the sacrificed animals. In mice bearing the HeLa cell tumors and treated with placebo, serum FR was slightly elevated compared with the mice that did not bear tumors (P < 0.1; Fig. 8B). Administration of dexamethasone to the tumor-bearing mice further increased their serum FR substantially (P < 0.01). These results show that dexamethasone induction of FR-α in a solid tumor in vivo will cause an increase in serum FR and that such a response to dexamethasone may be considered to be indicative of the presence of a FR-α-rich tumor.

In view of the large number of preclinical and clinical studies that show the considerable potential for the utility of FR as a target for tumor-selective delivery of a broad range of experimental therapies, there is a pressing need to address the problem of the variable and frequently limiting expression of FR in the target tumors. Recently published (28, 30, 31) and unpublished studies in our laboratory have shown that the FR gene family is regulated by nuclear receptors. The specific regulatory mechanisms, however, are quite varied but none involve classical response elements. Thus, ER acts by directly interacting with the proximal P4 promoter of the FR-α gene to repress it and this repressive effect is enhanced by estrogen; antiestrogens will bind to ER and de-repress FR-α transcription (28). Retinoid compounds act through each of the three retinoic acid receptors (α, β, and γ) in distinct ways, directly interacting with the FR-β gene to up-regulate its expression (30, 31). Other unpublished studies indicate the positive regulation of FR-α by the androgen receptor by direct interaction with proteins bound to an enhancer element in the FR-α gene as well as regulation of FR-α by the progesterone receptor. In this context, the regulation of FR-α by GR, as reported here, is particularly interesting because, unlike other steroid hormone receptors, GR is almost ubiquitously expressed (32). Furthermore, the many clinical applications of dexamethasone and the observation that variations in endogenous cortisol levels do not impact the physiologic effects of dexamethasone (33) also indicate that gene activation by endogenous glucocorticoids is suboptimal.

The results of this study clearly show that dexamethasone up-regulates the expression of the endogenous FR-α gene in cell lines in which the gene is transcriptionally active but not in a variety of cell types that are FR-α–negative; under these conditions, other active genes such as those encoding GAPDH, tubulin, and Sp family proteins were not regulated by dexamethasone. These observations are consistent with the nature of FR regulation by other nuclear receptors and are further supported by the lack of de novo FR expression in various FR-negative tissues in mice following dexamethasone treatment (data not shown). The dexamethasone-induced FR-α retained the desired characteristics of the receptor as a tumor target and a releasable tumor marker, i.e., it's anchoring to the membrane by glycosyl-phosphatidylinositol and its ability to bind ligand. A substantial induction of FR-α by dexamethasone was also observed in a murine tumor xenograft model, both within the tumor and in the serum, confirming the relevance of this regulation to the physiologic setting.

We undertook a study of the molecular processes involved in the action of GR on the FR-α gene, in the context of current knowledge of nuclear receptor functions, to provide a rational approach to designing and optimizing the use of GR ligands in FR-α targeting and FR-dependent diagnostics and to help to understand, anticipate and address associated problems. FR-α up-regulation in response to dexamethasone treatment was relatively slow and progressed even after dexamethasone was withdrawn as early as 6 hours of treatment. This suggests that dexamethasone does not act directly on the FR-α gene and that an early sequence of events involving dexamethasone action on some other target(s) precedes and is necessary for FR-α up-regulation. Further evidence that the expression of an intermediary protein factor in response to dexamethasone treatment is required to mediate the action of dexamethasone on the FR-α promoter is provided by the observation that blocking de novo protein synthesis in the early lag phase of dexamethasone action abolished the delayed activation of the promoter by dexamethasone. The dexamethasone action must be mediated by GR based on (a) the dexamethasone dose-dependence; (b) the inhibition of its action by the GR antagonist, RU486, and (c) potentiation of the dexamethasone effect by coactivators. Whereas the identity of the critical immediate (direct) target(s) of dexamethasone/GR action is unclear, the evidence points to the transcriptional nature of these early regulatory events as opposed to the more recently discovered nongenomic actions of steroid receptors (34, 35). This is evident from the GR coactivator dependence of the dexamethasone effect as well as potentiation of dexamethasone induction of FR-α by HDAC inhibition in the early (within 24 hours) as well as late phases (after 24 hours) of dexamethasone action.

Among the many protein modifications that occur as intermediate steps in transcriptional activation by nuclear receptors, histone acetylation is not only a key event for nuclear receptor function but is reversible, acutely regulated and may be specifically modulated by drugs that have negligible toxicity (36–38). All of the GR coactivators that were shown in this study to synergize with dexamethasone to enhance FR-α promoter activity, i.e., SRC-1 (NcoA-1), SRC-2 (GRIP1/TIF2/NcoA-2), and pCAF directly or indirectly promote histone acetylation (39). Nuclear receptor corepressors generate a transcriptionally repressed state by recruiting class II HDACs (40–43). Indeed, short chain fatty acids have been shown to sensitize cells to steroid hormones in vitro and in vivo both by activating the mitogen-activated protein kinase pathway and by inhibiting HDAC (44). Therefore, it was logical to test the effect of HDAC inhibitors on dexamethasone induction of FR-α. The short chain fatty acid, valproic acid (an antiepileptic and antineoplastic drug), and the hydroxamic acid, trichostatin A (a well characterized laboratory reagent), are both inhibitors of class I and II HDACs (36, 45). Valproic acid and trichostatin A both potentiated dexamethasone induction of FR-α at the transcriptional level, in their pharmacologically effective millimolar and nanomolar concentration ranges, respectively (36, 45). Despite the broad role of histone acetylation in gene regulation, HDAC inhibitors do not have global effects on gene expression. It has been established that these inhibitors alter the expression of only ∼2% of actively transcribed genes and that most of them have either minimal toxicity or no toxicity at their effective doses (36). The profound effects of HDAC inhibitors on dexamethasone induction of FR-α may be used to advantage in the receptor-targeted therapies and FR-dependent diagnostics in view of the fact that a variety of HDAC inhibitors that have acceptable toxicity profiles, which produce a sustained increase in the level of acetylated histones within hours (45), and that act on HDACs functionally associated with nuclear receptors are currently available (36, 46–48).

The results also show that the ultimate downstream site of action of dexamethasone in the FR-α gene is the proximal P4 promoter, more specifically, the G/C-rich Sp1 elements and the initiator and flanking region. Devoid of other regulatory elements, this portion of the FR-α promoter region represents the essential elements of a basal TATA-less promoter. The results of this study showed that a (Sp1 binding) G/C-rich region is essential for the dexamethasone response. The magnitude of this response not only correlated with the strength of the Sp1 element but also depended on the context of the initiator region. A common mechanism of gene regulation through G/C-rich elements involves differential levels and effects of Sp family proteins (49), but such a mechanism for the action of dexamethasone was ruled out in HeLa cells because the major Sp family proteins, Sp1, Sp3, and Sp4 all regulated the FR-α promoter in a similar manner and further, dexamethasone did not alter their expression levels or their apparent molecular weights that are influenced by their phosphorylation state. It thus seems that the ultimate action of dexamethasone in relation to FR-α regulation involves modulation of some component(s) of the transcription initiation complex, whose exact composition is dictated by both the G/C-rich and initiator regions. Such a supposition is reasonable in light of the emerging view that the recruitment of several components of the preinitiation complex is dictated by the basal promoter context (50).

The FR-α gene thus belongs to a class of indirect target genes of dexamethasone/GR that lack a GRE. Based on the foregoing studies, it is reasonable to anticipate that in individuals bearing an FR-α–positive tumor, brief treatment with the combination of innocuous doses of a GR agonist such as dexamethasone and a HDAC inhibitor will boost FR-α expression in the tumor and will, in addition, increase the serum level of FR. Such a treatment should greatly improve the outcome of FR-targeted therapies. GR modulation of FR-α expression also offers a means of using circulating FR as a serum marker to detect and follow the treatment response of major subtypes of ovarian, endometrial and other cancers. Indeed, elevation of serum FR in response to dexamethasone/HDAC inhibitor treatment may by itself serve as a diagnostic test for the presence of a FR-positive tumor. Following detection of the induced FR-α in the serum during initial screening, the FR-positive tumors may be detected by FR-targeted whole-body imaging. Similar principles of using general transcription modulators to induce or even down-regulate gene expression, selectively in tumors, concomitant with the administration of therapeutic agents whose action is dependent on the expression level of those genes, may be of value as a general concept in combination therapies. Such an approach is also applicable to the discovery of new tumor/serum markers.

Grant support: NIH grants CA 80183 and CA 103964 (to M. Ratnam), and NIH Institutional Pre-Doctoral NRSA grant CA 79450 (to T. Tran).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.