Table 1.

Somatic PIK3R1 mutations in primary endometrial tumors

Case no.HistologyMutated exon/intronPIK3R1 nucleotide changeaPredicted p85α amino acid changebPredicted effect on protein
EECs
 T85EndometrioidExon 12/intron 12c.1730_1745+3delGAGACCAATACTTGATGTAdelR577_M582insKcIn-frame insertion and deletion
 T88EndometrioidExon 8c.C1042TR348XPremature truncation
 T93EndometrioidExon 10c.1351_1356delGAATATdelE451_Y452In-frame deletion
 T93EndometrioidExon 10c.1373_1375delAAAdelK459In-frame deletion
 T95EndometrioidExon 10c.1369_1383delCAAGAAAAAAGTCGAdelQ457_R461In-frame deletion
 T100EndometrioidExon 10c.1348_1353delCATGAAdelH450_E451In-frame deletion
 T104EndometrioidExon 12c.1719_1727delGAGAAAGACdelR574_T576In-frame deletion
 T106EndometrioidIntron 10c.1426–13A>GQ475_E476insIMLQcIn frame insertion
 T119EndometrioidExon 8c.C1072TR358XPremature truncation
 T119EndometrioidExon 10c.1386_1387insTATGD464VfsX2Premature truncation
 T120EndometrioidExon 12c.1719_1727delGAGAAAGACdelR574_T576In-frame deletion
 T122EndometrioidExon 11c.1529_1530delAAK511VfsX2Premature truncation
 T124EndometrioidExon 15c.2103_2104insAGAAL702RfsX48Frameshift and extended protein
 T124EndometrioidIntron 7/exon 8c.1020–13_c.1026delGTTTTCATTTCAGGGAAGAANot determined
 T126EndometrioidIntron 10c.1426–9_1426–32delTATGACATTATCTTTTTAAAATTAQ475_E476insVLQcIn-frame insertion
 T126EndometrioidExon 12c.1624_1626delAGAdelR542In-frame deletion
 T128EndometrioidExon 10c.1365_1382delGTTTCAAGAAAAAAGTCGdelF456_R461In-frame deletion
 T129EndometrioidExon 11c.C1494AC498XPremature truncation
 T129EndometrioidExon 10c.1399_1425+2delTATGAAGAATATACCCGCACATCCCAGGTdelD434_Q475cIn-frame deletion
 T130EndometrioidExon 10c.1367_1382delTTCAAGAAAAAAGTCGAinsCTdelF456_R461insSIn-frame deletion/insertion
 T132EndometrioidExon 10c.1386_1397delATATGATAGATTdelY463_L466In-frame deletion
 T134EndometrioidExon 11c.G1483TE495XPremature truncation
 T137EndometrioidExon 10c.1425+2T>GdelD434_Q475cIn-frame deletion
NEECs
 T3SerousIntron 10c.1426–21C>ANot determined
 T3SerousIntron 8c.1119–25C>ANot determined
 T21Clear cellExon 10c.1386_1387delATY463XPremature truncation
 T28SerousExon 12c.A1690GN564DNucleotide substitution
 T61Clear cellExon 10c.1358_1390delACACTCAGTTTCAAGAAAAAAGTCGAGAATATGdelT454_D464In-frame deletion
 T74SerousExon 7c.C1002GY334XPremature truncation
 T77Clear cellExon 6c.C901TR301XPremature truncation
 T79SerousExon 8c.C1042TR348XPremature truncation
 T113Clear cellExon 10c.1372_1373insAS460KfsX5Premature truncation
 T113Clear cellExon 12c.A1643GD548GNucleotide substitution
  • aNucleotide positions are based on transcript ENST00000396611.

  • bAmino acid positions are based on protein ENSP00000379855.

  • cThe predicted protein change was determined by sequencing RT-PCR products to determine any effect of the mutated intronic bases on splicing.