Table 2

Microsatellite positions and primer conditions for LOH analysis

NamePositionSequenceSize (bp)aTypeReference or footnote
D17S85517q21bF5′GGATGGCCTTTTAGAAAGTGG143-155DN (46 , 47)
R5′ACACAGACTTGTCCTACTGCC
D17S85817q21F5′GCACTCTGACTAGAATCTGGGG131-127DN (46)
R5′TCCAAGTGGGAATGAGTGC
D17S132217q21F5′CTAGCCTGGGCAACAAACGA130 minTN c
R5′GCAGGAAGCAGGAATGGAAC
D17S132317q21F5′TAGGAGATGGATTATTGGTG155 minDN c
R5′AAGCAACTTTGCAATGAGTG
D13S26013q12.3F5′AGATATTGTCTCCGTTCCATGANADN (47 , 48)
R5′CCCAGATATAAGGACCTGGCTA
D13S17113q12.3F5′CCTACCATTGACACTCTCAG227-241DN (47 , 48)
R5′TAGGGCCATCCATTCT
TP53.PCR1517p13.1F5′ACTGCCACTCCTTGCCCCATTC103-135DN (49)
R5′AGGGATACTATTCAGCCCGAGGTG
TP5317p13.1F5′GAATCCGGGAGGAGGTTGNAPN (50)
R5′AACAGCTCCTTTAATGGCAG
  • a bp, base pair(s).

  • b F, forward primer; R, reverse primer; min, minimum bp size documented; NA, details not published; DN, dinucleotide repeat; PN, pentanucleotide repeat.

  • c D. Goldgar, 1994. Personal communication in OMIM (Online Mendelian Inheritance in Man). MIM Numbers GDB 375331 and 375323: Johns Hopkins University, Baltimore, MD. World Wide Web URL: http://www.ncbi.nlm.nih.gov/omim/