Table 3

PCR primers and reaction conditions for p53 mutation analysis

ExonPrimer pair (5′-3′)aPrimer concentration (μm)MgCl concentration (μm)Annealing temperature (°C)
5F; TTCCTCTTCCTGCAGTACTC0.8258
R; GCCCCAGCTGCTCACCATCG
6F; GCTGCTCAGATAGCGATGG0.4255
R; AGACCCCAGTTGCAAACCAG
7F; GTGTTATCTCCTAGGTTGGC0.125255
R; AAGTGGCTCCTGACCTGGAG
8F; AGTGGTAATCTACTGGGACG0.42.555
R; AGGCATAACTGCACCCTTGG
9F; CAAGGGTGCAGTTATGCC0.8258
R; AACTTTCCACTTGATAAGAGGTC
10F; GTACTGTGAATATACTTACTTCTCC0.8258
R; GGGCTGAGGTCACTCACC
  • a F, forward primer; R, reverse primer.