Table 1

Primers used for PCR and sequencing

DesignationSequence (5′ → 3′)DirectionPositionGene (accession no.)
TELR1CCTGCTCCAGTAAATTGGCTGCAAGCGReverse187–213ETV6 (NM_001987)
TELR2GGCAGGCGGATCGAGTCTTCCTCCReverse153–176ETV6 (NM_001987)
TELF1GATCTCTCTCGCTGTGAGACATGForward5–27ETV6 (NM_001987)
TEL301RCTCTTTGGTCAGCAGCAGGAGAGCReverse301–324ETV6 (NM_001987)
TEL135RGTGGAAGAATGGTGAAAGAATCCGAGGReverse400–429ETV6 (NM_001987)
TEL143RCTGTGAGTGTATAGAGTTTCCAGGGTGReverse427–453ETV6 (NM_001987)
TEL163RCCTGGGCCTCCTCTGGACACAGTTATCReverse487–513ETV6 (NM_001987)
TEL172RGTTATGGTGCACATTATCCACGGATGGReverse514–540ETV6 (NM_001987)
ETV6F1aTGAGACATGTCTGAGACTCCTGCTForward19–42ETV6 (NM_001987)
ETV6F1bACTCCTGCTCAGTGTAGCATTAAGForward34–57ETV6 (NM_001987)
HLXB9-545FCGCTCTCCTACTCGTACCCGCAGForward545–567HLXB9 (NM_005515)
HLXB9-604FATCAAGCTGGGCGCCGGCACCTForward604–625HLXB9 (NM_005515)
HLXB9-624FCTTCCAGCTGGACCAGTGGCTGForward624–645HLXB9 (NM_005515)
HLXB9-989RGGCCCCAGCAGCTCCTCGGCTCReverse989–1010HLXB9 (NM_005515)
HLXB9-1092RTGCTGTAGGGGAAATGGTCCTCGReverse1092–1114HLXB9 (NM_005515)
C7orf3-608FTCAGTGGGCAGCTGGAGGAACTGForward609–631C7orf3 (AF107455)
C7orf3-712FGCCCAGCAGACTGATGATGGAGCForward712–734C7orf3 (AF107455)