Table 1

Oligonucleotide and probe sequences used for quantitative real-time PCR

Oligonucleotide sequence (5′–3′)
Cyclin D1 FPTCCATCCGGCCCGAG
Cyclin D1 RPGAGCTTGTTCACCAGGAGCAG
Cyclin D2 FPCTACATGCGCAGAATGGTGG
Cyclin D2 RPAGCACCCAGGAGTTGCAGAT
Cyclin E FPCCCATCCTTCTCCACCAAAG
Cyclin E RPCCCTGTTTGATGCCATCCAC
P21Waf1/CIP1 FPCGCTAATGGCGGGCTG
P21Waf1/CIP1 RPCGGTGACAAAGTCGAAGTTCC
P27KIP1 FPGAGGACACGCATTTGGTGG
P27KIP1 RPGCTCCTCTAACCCCGTCT
PPARγ FPGGCTTCATGACAAGGGAGTTTC
PPARγ RPAACTCAAACTTGGGCTCCATAAAG
 β2MG FPAGCTGTGCTCGCGCTACTCT
 β2MG RPTTGACTTTCCATTCTCTGCTGG
Probe sequence 5′(FAM)-(TAMRA)3′
Cyclin D1 probeCTGCTGCAAATGGA
Cyclin D2 probeTGTGAGGAACAGAAGTGCGAAGAAGAGGTC
Cyclin E probeAGTTGCGCGCCTGCTCCACG
P21Waf1/CIP1 probeATCCAGGAGGCCCGTGAGCGA
P27KIP1 probeCCCAAAGACTGATCCGTCGGACAGC
PPARγ probeAAAGAGCCTGCGAAAGCCTTTTGGTG
 β2MG probeTCTTTCTGGCCTGGAGGGCATCC
  • FP: forward primer; RP: reverse primer.