Table 1.

The sequence of rearranged TCR╬▓ chain genes and frequency in Pmel-1 iPSC-derived DP, CD8 SP on OP9-DL1 cells and splenic CD8+ T cells

Cell typeProductive rearrangementProductive frequencyFrequencyAmino acid
Pmel-1 iPSC-TCRBV14-01*01
CD8+ T cellsTCRBD01-01*0197.8%93.2%CASSFHRDYNSPLYF
TCRBJ01-06*01
Pmel-1 splenicTCRBV14-01*01
CD8+ T cellsTCRBD01-01*0197.8%95.0%CASSFHRDYNSPLYF
TCRBJ01-06*01
Cell typeNucleotide
Pmel-1 iPSC-
CD8+ T cells and Pmel-1 splenic CD8+ T cells
CTCAAGATCCAGTCTGCAAAGCAGGGCGACACAGCCACCTATCTCTGTGCCAGCAGTTTCCACAGGGACTATAATTCGC-CCCTCTAC