Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Focus on Computer Resources
      • Highly Cited Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Early Career Award
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citations
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • My Cart

Search

  • Advanced search
Cancer Research
Cancer Research
  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Focus on Computer Resources
      • Highly Cited Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Early Career Award
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citations
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

Advances in Brief

Evidence That Genetic Instability Occurs at an Early Stage of Colorectal Tumorigenesis

Ie-Ming Shih, Wei Zhou, Steven N. Goodman, Christoph Lengauer, Kenneth W. Kinzler and Bert Vogelstein
Ie-Ming Shih
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Wei Zhou
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Steven N. Goodman
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Christoph Lengauer
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Kenneth W. Kinzler
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Bert Vogelstein
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI:  Published February 2001
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Fig. 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig. 1.

    A, H&E-stained section of a typical adenomatous polyp used in this study. The adenoma was 2 mm in greatest dimension. B, higher magnification demonstrates dysplastic epithelium overlying the lamina propria, with abundant lymphocytes and stromal cells that are typically observed in these lesions.

  • Fig. 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig. 2.

    A, examples of digital SNP genotyping data. DNA from microdissected normal (upper panel) and adenoma (bottom panel) samples was distributed to a 384-well PCR plate. After PCR, a pair of allele-specific Molecular Beacons, labeled with fluorescein or Hex, was added to each well to determine allelic status. The fluorescein: Hex fluorescence ratio was then determined. Wells that were green or red corresponded to those containing PCR products derived from only one of the two alleles. Wells with only background fluorescence were uncolored and represent wells that contained no DNA template molecules. Wells that were yellow contained an intermediate green: red fluorescence ratio, resulting from the presence of both alleles. Such results are expected based on a Poisson distribution.4 B, SPRT analysis of normal and adenoma samples from A. X axis, total number of alleles counted; Y axis, observed proportion of the two alleles. The allelic proportion of DNA from the normal colonic mucosae is below curve 2 and is therefore interpreted as being in allelic balance. In contrast, the allelic proportion in the DNA from the adenoma is above curve 1, and this tumor is interpreted to have AI.

  • Fig. 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig. 3.

    SPRT analysis on different chromosomal arms. X axis, total number of alleles counted; Y axis, observed proportion of the two alleles for each of the chromosome arms indicated. The boundary SPRT values corresponding to a likelihood ratio of 8 are shown as curved lines, as in Fig. 2 <$REFLINK> . All points above the upper boundary were interpreted to have AI, whereas those below the lower boundary were interpreted to have no AI.

  • Fig. 4.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig. 4.

    Summary of digital SNP results. ▪, chromosome arms in which AI was identified through digital SNP; Embedded Image, chromosome arms in which both alleles were in balance; □, chromosome arms that could not be evaluated because all SNP markers tested were uninformative in the normal mucosae or because the allelic ratio in SPRT analysis did not fall above curve 1 or below curve 2.

Tables

  • Figures
  • Table 1

    Primers and probes used for digital SNP analysis

    ChSNPsForward primerReverse primerInternal primerMolecular Beacon-green (fluorescein)Molecular Beacon-red (Hex)
    1pCGAP-C-51904CCCTGGACCCCCTGATGGGCCGAGTCAGTGGCAAAAGGCCGAGTCAGTGGCAAAAGCACGCCGAGCTCGCTCCGGAACGTGCACGCCGAGCTCACTCCGGAACGTG
    1pCGAP-C-53916ACAGCTTGGGAACGCAGAGGTGTCTGATTTGCCACCTGGATTGTCTGATTTGCCACCTGGATCACGCCGTAACTGAACGTGCTCGTGCACGCCGTAACTCAACGTGCTCGTG
    1pCGAP-C-50319CAGGGCAAGACGCTGTGGTAACAGAATGTGCTTCCCTCCCAACAGAATGTGCTTCCCTCCCCACGCTGCCCAGCGCACGGCCGTGCACGCTGCCCAGTGCACGGCCGTG
    1pAA290678AGCAGCATGACTGAACATCGACACTTACCTGACAGCGGATGACACTTACCTGACAGCGGATCACGAGGCCAACGACGAGAGCCCACGTGCACGAGGCCAACGCCGAGAGCCCACGTG
    15qCGAP-C-2077CAAGACTGTAAGAACGTAGGAGTCTCTATTTATTTGTCCTCTTAGTGAAGGAAGGATGCTCGCACGTTAGACTTTGACCCAGAGCCGTGCACGTTAGACTTTGACCCAGCGCGTG
    15qCGAP-C-1861ACAGCCATTTATTATGTTTACTTGGAGAATAATTGTGATAAGAATTCCCCCCCACCAAAATCACCTCCCACGAGCCAACACGGAGGTGACGTGCACGAGCCAACATGGAGGTGACGTG
    15qCGAP-C-362TCACACCTGAGGGGGAAGAGCCATAGGAAGGTGAGGAATGTCATCTGTAGTCCAAGGTCCACGCTGACGAGACACAGAGACCTCGTGCACGGACGAGACGCAGAGACCTCGTG
    15qCGAP-C-425GTCTCACTTTCTTGTCTAGGCTGAGGAATAACTGGATTTCATCGGTGATTAAGTATTCCCCACCCCACGAAGACTCACCAGAACAGGGCGTGCACGAAGACTCACCAGAAGAGGGCGTG
    8pCGAP-C-3833GCCCAACACTGAGCTCTTTCGGTCTGATGTCAGTAACGGGGTCTGATGTCAGTAACGGCACGTTGCTCTTCAATTCCGTTCCGTGCACGTTGCTCTTCAGTTCCGTTCCGTG
    8pCGAP-C-1596CCACTTGGGTCTCTTTCAAGCAGAAAAACAGACTAAGGCGGCTTTAGAACAGGAACGCACGTCAAGTGAATGTTCCTTTCGTCGTGCACGTCAAGTGAATTTTCCTTTCGTCGTG
    8pCGAP-C-28254GAAATCAGGTTAGTTTAGTCTACAGCGTGTGTTGAGATAAATTCAGATACGTGTGTTGAGATAAATTCAGATACCACGCGATGACTACTCTCTCTTGCCGTGCACGCGATGATTACTCTCTCTTGCCGTG
    8pCGAP-C-1745CATGAAAGGAAAGGGTGCCAGCGACTTCACCTAAACCGCTGAATGCTCTGCCATGAGCACGGCTGCTTGCGGCTCATCGTGCACGTGCTGCTTGTGGCTCATCGTG
    8pCGAP-C-32628AAATGGGAGCAGTGAGTGGCCCCTCCTAAGCCAGCTCACCCCTCCTAAGCCAGCTCACCACGGAACAACTGTTGAATGATGCGTGCACGGAACAACTGCTGAATGATGGCGTG
    8pCGAP-C-1085CACTGAATGCTCTGCCATGAAACCTGTCCTTGTGGGTGATGGTGATGATCACTGTGCTGCCACGATGAGCCACAAGCAGCACGTGCACGATGAGCCGCAAGCAGCCGTG
    18qCGAP-C-1239AAGGATGGCGCACGCTGGTCACTATCTCCCGGTTGTCGTCACTATCTCCCGGTTGTCGCACGTGGGAGGACAGGGTACGCGTGCCAGGGGAGAACGGGGTACGCGTG
    18qCGAP-C-700CTGAAACTAATGAGGTGCTAAATCAGCCCATTGCATTATCATCGCATTCTTTGACCTTTCACCAATCACGTATCCTTCCATGAAATTGGCGTGCACGTATCCTTCCGTGAAATTGGCGTG
    18qCGAP-C-331GACAAAGAGGCAGTTTCTGTAGTTTGTTCATTAATTTCACTTACAGGAAACTTACAGGAATGGCATGGCCACGTTGAGACTACGTGGCCATCGTGCACGTTGAGACTATGTGGCCATGCGTG
    18qCGAP-C-801AGATGTCAGTTTGAATGTATTCCTGTGAGTCTCACTCATATTTTCGGGTGAGTCTCACTCATATTTTCGGGCACGTATTCCTGATGTTTTCCTTTCGTGCACGTATTCCTGATCTTTTCCTTTCGTG
    18qCGAP-C-1432GGAGAAATTTCTTTGATTTATGCTGTTTATCTTAGTGTTTCTGGCCCTTGGTCTTTATTATTAGATTGCACGTGTGAATTGCAGGTTTCCCGTGCACGATGTGAATTGTAGGTTTCCACGTG
    18qCGAP-C-1468AGCGAGCATCAGAATCACCTCGGGACAAGCAGCATCTGCAACACTTAGGAAGGTCTCACGTGGGGCTTACAAATTAGTATCGTGCACGTGGGGCTTACGAATTAGTATCGTG
    5q486GGACTACAGGCCATTGCAGAATCCAGCATATCGTCTTAGTGTTCCAGCATATCGTCTTAGTGTCACGGTGAAATGTACGGGCTTACTCGTGCACGGTGAAATGTATGGGCTTACTACGTG
    5q310AGAGGATGAGCATGCTGGTGGAGGTTACTCTGGATGCACTAGGTTACTCTGGATGCACTCACGGTAGGAAGACAGCGCGAGCGTGCACGAATCCAATGCCACAGCGCTGCGTG
    5q1756GTCACAAGCCTTTCCGTGTGAAAGGTATAGGTTTTACTGGTGAAGTTGGGGTATAGGTTTTACTGGTGAAGTTGGCACGTCTGCGTCGTCTTCTGCCGTGCACGATCTGCGTCTTCTTCTGCCGTG
    5q1960AGGGGCAGCAACTGATGAAAAGCTTGGTCAATGTCACTGAGAGACTTGGTCAATGTCACTGAGAGACACGGAAAATACTCCAGTTTGCTTCGTGCACGGAAAATACTCCGGTTTGCCGTG
PreviousNext
Back to top
Cancer Research: 61 (3)
February 2001
Volume 61, Issue 3
  • Table of Contents

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Research article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Evidence That Genetic Instability Occurs at an Early Stage of Colorectal Tumorigenesis
(Your Name) has forwarded a page to you from Cancer Research
(Your Name) thought you would be interested in this article in Cancer Research.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Evidence That Genetic Instability Occurs at an Early Stage of Colorectal Tumorigenesis
Ie-Ming Shih, Wei Zhou, Steven N. Goodman, Christoph Lengauer, Kenneth W. Kinzler and Bert Vogelstein
Cancer Res February 2 2001 (61) (3) 818-822;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Evidence That Genetic Instability Occurs at an Early Stage of Colorectal Tumorigenesis
Ie-Ming Shih, Wei Zhou, Steven N. Goodman, Christoph Lengauer, Kenneth W. Kinzler and Bert Vogelstein
Cancer Res February 2 2001 (61) (3) 818-822;
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Recombinant Listeria Vaccines Containing PEST Sequences Are Potent Immune Adjuvants for the Tumor-Associated Antigen Human Papillomavirus-16 E7
  • Granulocyte-Macrophage Colony-Stimulating Factor and Interleukin-2 Fusion cDNA for Cancer Gene Immunotherapy
  • 2-Arachidonoylglycerol
Show more Advances in Brief
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook  Twitter  LinkedIn  YouTube  RSS

Articles

  • Online First
  • Current Issue
  • Past Issues
  • Meeting Abstracts

Info for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Cancer Research

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Cancer Research Online ISSN: 1538-7445
Cancer Research Print ISSN: 0008-5472
Journal of Cancer Research ISSN: 0099-7013
American Journal of Cancer ISSN: 0099-7374

Advertisement