Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • Log out
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Focus on Computer Resources
      • Highly Cited Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Early Career Award
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citations
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Cancer Research
Cancer Research
  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Focus on Computer Resources
      • Highly Cited Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Early Career Award
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citations
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

Advances in Brief

Prostaglandin E2 Stimulates the Growth of Colon Cancer Cells via Induction of Amphiregulin

Jinyi Shao, Sean B. Lee, Huiping Guo, B. Mark Evers and Hongmiao Sheng
Jinyi Shao
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sean B. Lee
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Huiping Guo
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
B. Mark Evers
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Hongmiao Sheng
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI:  Published September 2003
  • Article
  • Info & Metrics
  • PDF
Loading

Abstract

Prostaglandin E2 (PGE2), a major product of cyclooxygenase enzymes, is implicated in colorectal carcinogenesis and has been shown to stimulate the growth of human colorectal carcinoma cells. Here, we show that PGE2 activated the cyclic AMP/protein kinase A pathway, which induced the expression of amphiregulin (AR), an epidermal growth factor family member, through activation of a cyclic AMP-responsive element in the AR promoter. AR exerted a mitogenic effect on LS-174 cells and partially mediated the PGE2-induced growth stimulation. In addition, PGE2, in collaboration with transforming growth factor-α or K-Ras oncogene, synergistically induced AR expression and activated receptor tyrosine kinase-dependent signaling pathways. Our results provide novel mechanisms for cyclooxygenase-2 pro-oncogenic activity and suggest that PGE2 may act with major oncogenic pathways in a synergistic fashion to activate the epidermal growth factor receptor signaling system through a ligand-dependent autocrine pathway.

Introduction

It is now clear that COX 3 -2 plays a role in the promotion of colorectal cancer (1) . However, the effects of PGs generated by COX-2 have largely been unexplored. PGE2, a major product of COX enzymes, acts via specific transmembrane GPCRs (2) . Four PGE receptor (EP) subtypes have been identified. EP1 receptor signals via generation of inositol 1,4,5-triphosphate and increased intracellular Ca2+. EP2 and EP4 receptors are coupled to Gs proteins and signal through increased cAMP, whereas the EP3 receptor is coupled to inhibitory G proteins, which inhibit the generation of cAMP. It has been known for quite some time that short-term administration of PGE2 causes significant stimulation of DNA synthesis; prolonged PGE2 treatment markedly increases the weight, DNA, and RNA content of intestinal mucosa in rats (3) . PGE2 stimulates proliferation and growth of human colorectal cancer cells (4, 5, 6) . These in vivo and in vitro findings suggest that COX-2-generated PGE2 may provide a growth advantage to colorectal carcinomas.

The EGF family and their cognate receptors (EGFRs), now referred to as the ErbB family, play critical roles in intestinal epithelial growth and transformation (7) . Binding of the ligand to the EGFR leads to activation of RTKs that phosphorylate tyrosine residues of cellular signaling proteins and activate signaling pathways that are essential for intestinal epithelial proliferation (8) . EGFR cross-communicates with GPCRs and can be transactivated by GPCR agonists (9) . In a recent study, Pai et al. (4) reported that PGE2 transactivates EGFR, triggers extracellular signaling-regulated kinase activation, and stimulates the proliferation of colorectal carcinoma cells. These studies demonstrate clearly that PGE2 growth stimulation in colon cancer cells involves activation of the EGFR signaling system. We have reported previously that treatment with PGE2 increases PI3K/Akt activity that is critical for the transformation of intestinal epithelial cells and that is required for the growth stimulation of PGE2 in human colon cancer LS-174 cells (6) . To better understand the mechanism(s) by which PGE2 activates RTK-dependent signaling pathways and stimulates colon cancer cell growth, we investigated the regulation and functional role of a PGE2 target gene, AR, in PGE2 trophic activity. PGE2 signaled through Gs-coupled receptors and activated PKA which, in turn, induced the expression of AR, a member of the EGF family, through transcriptional activation of a CRE in the AR promoter. AR exerted a mitogenic effect on LS-174 cells and mediated the trophic effect of PGE2 in human colon cancer cells. Moreover, PGE2, in cooperation with major oncogenic pathways, synergistically induced AR transcription. These results provide additional mechanisms mediating COX-2/PGE2 pro-oncogenic actions in colorectal carcinogenesis.

Materials and Methods

Cell Culture.

LS-174 cells were purchased from American Type Culture Collection (Manassas, VA) and were maintained in McCoy’s 5A medium containing 10% fetal bovine serum. The growth of cells in Matrigel (Collaborative Biomedical, Bedford, MA) was carried out as described previously (6) . PGE2 was purchased from Cayman Chemical (Ann Arbor, MI). H-89, LY-294002, and PD-153035 were purchased from Calbiochem (San Diego, CA). Dibutyryl cAMP was purchased from Sigma (St. Louis, MO). Amphiregulin, goat normal IgG, and anti-AR antibody were purchased from Research and Development Systems (Minneapolis, MN).

PKA Assay.

cAMP-dependent PKA activity was measured by determining the transfer of the phosphate group of ATP to a synthetic peptide, which is a substrate for PKA (Calbiochem). The experiment was carried out according to the manufacturer’s instructions.

GeneChip Hybridization.

This experiment was performed in the University of Iowa DNA Facility (10) . Briefly, cRNA preparations from PGE2 or vehicle-treated LS-174 cells were used to inoculate human GeneChip (U95A) expression arrays (Affymetrix, Inc.) based on a recommended protocol. Three replicate hybridizations were performed using PGE2 or vehicle-treated RNA samples. Alterations in RNA transcript levels were analyzed using Affymetrix Analysis Suit 4.0 software. The fold change in expression between groups was calculated from the mean average difference scores.

RNA Extraction and Northern Blot Analysis.

The extraction of total cellular RNA was carried out as described previously (11) . RNA samples (20 μg/lane) were separated on formaldehyde-agarose gels and blotted onto nitrocellulose membranes. The blots were hybridized with cDNA probes labeled with [α-32P]dCTP by random primer extension (Stratagene, La Jolla, CA). After hybridization and washes, the blots were subjected to autoradiography.

Transient Transfection and Luciferase Assay.

The assays to determine the activity of the AR promoter were described previously (11) . Reporter constructs pGL2-A, pGL2-B, pGL2-BΔCRE, pGL2-C, and pGL2-CΔCRE containing the 5′-flanking region of the human AR gene were described previously (12) . For transient transfections, cells were cotransfected with 0.5 μg of one of the AR firefly luciferase plasmid constructs and 3 ng of the pRL-SV40 plasmid, containing the Renilla luciferase gene (Promega Corp., Madison, WI), using the FuGENE 6 procedure (Roche, Indianapolis, IN) as described in the manufacturer’s protocol. Transfected cells were lysed at the indicated times for luciferase assay. Firefly and Renilla luciferase activities were measured using a Dual-Luciferase Reporter assay system (Promega) and a luminometer. Firefly luciferase values were standardized to Renilla values.

Immunoblot Analysis.

Immunoblot analysis was performed as described previously (11) . The anti-phosphorylated Akt antibody and anti-pCREB antibody were purchased from Cell Signaling (Beverly, MA).

Real-Time RT-PCR.

AR expression was quantified using real-time quantitative PCR or TaqMan technique (Applied Biosystems, Foster City, CA). The sequence of the primer/probe set was based on AR mRNA sequence (GenBank NM_001657) and includes: probe, AGTCCAGCTTAGAAGAC; forward primer, GCCTTTATGTCTGCTGTGATCCT; and reverse primer, CCTCAGCTTCTCCTTCATATTTCCT. 18S rRNA TaqMan assay reagent was used for internal control. One-step RT-PCR was performed with 40 ng of RNA for both target gene and endogenous controls. Duplicate CT values were analyzed in Microsoft Excel using the comparative CT (ΔΔCT) method as described by the manufacturer (Applied Biosystems). The amount of target (2−ΔΔCT) was obtained as normalized to 18 S and relative to a calibrator.

Data Analysis.

All statistical analyses were performed on a personal computer with the StatView 5.0.1 software (SAS Institute, Inc., Cary, NC). Analyses between multiple groups were determined by ANOVA. Analyses between two groups were determined using the unpaired Student t test. Differences of P < 0.05 were considered statistically significant.

RESULTS

PGE2 Stimulated LS-174 Cell Growth through the cAMP/PKA Pathway. PGE2 may signal through four EP receptor subtypes, which act through different signaling pathways (2) . By using single-cell [Ca2+]i imaging, we found that PGE2 treatment did not alter intracellular Ca2+ levels in LS-174 cells (data not shown). In contrast, PGE2 activated the cAMP/PKA signaling pathway (Fig. 1A) ⇓ . Stimulation with PGE2 rapidly increased PKA activity by ∼7-fold in LS-174 cells. A selective PKA inhibitor, H-89, at 10 μm completely blocked the PGE2-induced PKA activity. Similar results were observed in LS-174 cells that were treated with dibutyryl cAMP (0.1 mm), suggesting that PGE2 signaled through Gs protein-coupled receptors and increased the levels of cAMP in LS-174 cells. In agreement with previous studies (13) that inhibition of PKA activity with antisense oligodeoxynucleotide impairs the growth of LS-174 cells, 10 μm H-89 significantly inhibited LS-174 cell growth in Matrigel (Fig. 1B) ⇓ . LS-174 cells formed colonies in Matrigel, and PGE2 treatment increased the volume of colonies ∼4-fold. Addition of H-89 blocked the PGE2 stimulation of LS-174 cell growth in Matrigel. Thus, PKA activation appeared to be critical for PGE2 stimulation of LS-174 cell growth.

Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1.

PGE2 activation of the cAMP/PKA pathway. A, PGE2 induction of PKA. LS-174 cells were serum deprived for 48 h and then treated with PGE2 (0.1 μm) or dibutyryl cAMP (0.1 mm) for 10 min in the presence or absence of H-89 at the indicated concentrations. PKA activity was measured by determining the transfer of the phosphate group of ATP to a synthetic peptide, which is a substrate for PKA. Results were normalized by the controls and expressed as relative PKA activity. Plotted is the means of assays performed in triplicate of two independent experiments; bars, SD. ∗, P < 0.05. B, PKA activity and LS-174 cell growth in Matrigel. LS-174 cells were grown in Matrigel with indicated treatment for 10 days (V, vehicle; E2, 0.1 μm PGE2; H-89, 10 μm H-89). Colonies were photographed (×40), and the size of 60 colonies from each group was measured. Relative colony size to the control group is plotted. ∗, P < 0.05. This experiment was repeated three times.

PGE2-induced AR Expression.

To search for target genes that may mediate PGE2 growth-stimulatory activity in colon cancer cells, LS-174 cells were treated with PGE2 or vehicle for 2 h; cRNA preparations were hybridized to Affymetrix GeneChips. The expression of 14 genes, which included transcription factors, enzymes, immune-related genes, and growth factors, was increased 3–10.5-fold in response to PGE2 stimulation. Among these genes, AR, a member of the EGF family, was induced 9-fold after PGE2 treatment. Because AR stimulates the growth of colon cancer cells (14) , we decided to further investigate roles of AR in PGE2 growth-stimulatory action. To confirm the findings generated from GeneChip assays, Northern analysis was conducted; levels of AR mRNA were increased 3–4-fold in LS-174 cells after treatment with PGE2 for 2 h and returned to basal levels by 8 h (Fig. 2A) ⇓ .

Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2.

PGE2 induction of AR expression. A, Northern analysis of AR mRNA. LS-174 cells were serum deprived for 48 h and then treated with 0.1 μm PGE2 for the indicated times. Total RNA was extracted, and levels of AR were detected using Northern blot analysis. The results were densitometrically analyzed using Image J software and standardized by the control values (0 h). Plotted is the mean of three independent experiments; bars, SD. ∗, P < 0.05. B, PGE2 induction of AR promoter activity. LS-174 cells were transiently transfected with pGL2-A containing the nucleotide sequence of 763 bp (−850 to −87) of AR 5′-flanking region. Nucleotide numbers refer to promoter sequence (12 , 15) . Cells were serum deprived for 24 h before vehicle (V), H-89, PGE2 (E2), or PGE2 plus H-89 (E2 + H-89) treatment. Firefly and Renilla luciferase activities were measured, and firefly luciferase values were standardized to Renilla values. Renilla Adjusted RLU, Renilla-adjusted luciferase values standardized to the controls. Plotted is the mean of assays performed in quadruplicate, based on three independent experiments; bars, SD. ∗, P < 0.05.

To determine the mechanism by which PGE2 induced AR expression, we investigated the role of PGE2 signaling in AR transcription. The nucleotide sequence of a 763-bp AR 5′-flanking region has been cloned and analyzed (12 , 15) . When LS-174 cells were transiently transfected with the reporter vector pGL2-A, which contains the AR promoter sequence from −850 to −87, PGE2 treatment rapidly increased the transcriptional activity of AR and resulted in an ∼7-fold increase in luciferase activity (Fig. 2B) ⇓ . PKA activation was critical for the PGE2-stimulated AR transcription, which was completely blocked by the presence of H-89. These results suggest that PGE2-induced AR transcription was mediated by the PKA signaling pathway.

Roles of the CRE in PGE2 Activation of the AR Promoter.

cAMP stimulates the expression of target genes through a conserved CRE. A CRE site has been identified previously in the AR promoter (15) . The 155-bp sequence immediately upstream of the 5′ end of the mRNA start site includes a consensus TATA box (−238 to −233) and a CRE (−274 to −267). To elucidate the role of the CRE site in PGE2-induced AR transcription, LS-174 cells were transfected with pGL2-B, which contains 136 nucleotides (−328 to −192) including the Wilms’ tumor suppressor WT1 responsive element, the CRE, and the TATA box. Luciferase activity was increased (∼5-fold) by PGE2 stimulation compared with vehicle-treated cells (Fig. 3A) ⇓ . Mutation of the CRE site from GACGTCA to GACGTAC (pGL2-BΔCRE) resulted in a significant reduction of AR promoter activity and almost completely attenuated PGE2-induced AR transcription. Using pGL2-C and pGL2-CΔCRE report vectors, which contain only 83 nucleotides (−275 to −192) including the CRE and the TATA box, we confirmed the critical role of the CRE in PGE2-induced AR transcription (Fig. 3B) ⇓ . Transcriptional activation of the CRE requires activated transcription factors of the CREB protein, which is phosphorylated at Ser-133 by the PKA catalytic subunit and interacts with the CRE. PGE2 treatment significantly increased the phosphorylation of CREB protein at Ser-133 in LS-174 cells (Fig. 3C) ⇓ .

Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3.

PGE2 activation of the CRE in the AR promoter. A, the role of the CRE in PGE2 activation of AR transcription. LS-174 cells were transiently transfected with pGL2-B or pGL2-BΔCRE (pGL2-BΔ). Cells were then treated with vehicle (V) or PGE2 (0.1 μm; E2) for 6 h. Firefly and Renilla luciferase activities were measured and standardized. Plotted is the mean of assays performed in quadruplicate; bars, SD. ∗, P < 0.05. Results shown are representative of five separate experiments. B, LS-174 cells were transiently transfected with pGL2-C or pGL2-CΔCRE (pGL2-CΔ). Cells were then treated with vehicle (V) or PGE2 (0.1 μm; E2) for 6 h. Firefly and Renilla luciferase activities were measured and standardized. Plotted is the mean of assays performed in quadruplicate; bars, SD. ∗, P < 0.05. Results shown are representative of five separate experiments. C, PGE2 induction of pCREB. LS-174 cells were serum deprived for 48 h before PGE2 treatment. Cellular protein was collected at the indicated time points for detection of phosphorylated CREB (Ser-133). This experiment was repeated three times.

AR Mediated the Trophic Action of PGE2.

It was critical for us to determine the role of AR in LS-174 cell growth. Treatment with AR increased the growth rate of LS-174 cells and resulted in a >2-fold increase in cell number. The growth-stimulatory effect of AR was completely blocked by an EGFR tyrosine kinase inhibitor, PD-153035 (1 μm; Fig. 4A ⇓ , left panel). AR stimulated DNA synthesis in LS-174 cells that was partially blocked by an anti-AR neutralizing antibody (Fig. 4A ⇓ , middle panel). AR also increased the colony size of LS-174 cells when grown in Matrigel that was completely attenuated by the addition of 1 μm PD-153035 (Fig. 4A ⇓ , left panel). These results indicate that AR is a mitogenic growth factor for LS-174 cells.

Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4.

AR in PGE2 trophic action. A, AR stimulation of LS-174 cell growth. Left panel, 104 LS-174 cells were seeded in 12-well plates and treated with vehicle (V), AR (100 ng/ml), or AR plus PD-153035 (1 μm) for 4 days. ∗, P < 0.05. Middle panel, LS-174 cells were seeded in 24-well plates and treated with vehicle (V), AR (100 ng/ml), or AR plus anti-AR antibody (20 μg/ml) for 24 h. [3H]]Thymidine incorporation was measured. ∗, P < 0.05. Right panel, LS-174 cells were grown in Matrigel and treated with vehicle (V), AR (100 ng/ml), or AR plus PD-153035 (1 μm) for 10 days. Relative colony size was determined. ∗, P < 0.05. All growth studies in A were repeated three times. B, AR and PGE2 induction of PI3K activity. LS-174 cells were serum deprived for 48 h before the indicated treatments (AR, 100 ng/ml; PGE2, 0.1 μm; PD153035, 1 μm). Protein lysates were extracted at the indicated time points and subjected to Western analysis. Results were similar in two independent experiments. C, inhibition of RTK and PGE2 growth stimulation. Left panel, 2.5 × 104 LS-174 cells were seeded in 12-well plates and grown in serum-deprived medium with the indicated treatments for 4 days. V, vehicle; E2, PGE2 (0.1 μm); PD, PD-153035 (1 μm). Cell numbers were counted, and values are means from triplicate wells; bars, SD. ∗, P < 0.05. Results were similar in three independent experiments. Middle panel, serum-deprived LS-174 cells were treated with vehicle (V) or PGE2 (0.1 μm) in the presence of normal IgG or anti-AR antibody (αAR) for 24 h. [3H]]Thymidine incorporation was measured. ∗, P < 0.05. Results were similar in two independent experiments. Right panel, LS-174 cells were grown in Matrigel with the indicated treatment for 10 days. V, vehicle; E2, PGE2 (0.1 μm); PD, PD-153035 (1 μm). Colonies were photographed, and the size of 60 colonies from each group was measured. Relative colony size to the control group is shown. ∗, P < 0.05. Results were similar in two independent experiments.

Next, we investigated the functional involvement of AR in PGE2-induced growth stimulation. Both AR and PGE2 treatment increased PI3K activity, as noted by increased levels of pAkt that is critical for PGE2 stimulation of LS-174 cell growth (6) . Inhibition of EGFR activity by PD-153035 (1 μm) blocked PGE2-induced pAkt (Fig. 4B) ⇓ , suggesting that PGE2 induction of PI3K activity required activation of EGFR. PGE2 treatment promoted the growth of LS-174 cells; this effect was blocked by inhibition of RTK activity (Fig. 4C ⇓ , left panel). PGE2 modestly increased DNA synthesis in LS-174 cells; addition of an anti-AR neutralizing antibody before PGE2 treatment completely attenuated the PGE2-induced DNA synthesis (Fig. 4C ⇓ , middle panel). PGE2 significantly increased the colony volume of LS-174 cells when grown in Matrigel; again, EGFR activity was critical for the growth-stimulatory effect of PGE2 (Fig. 4C ⇓ , right panel). These results demonstrate clearly that PGE2 growth-stimulatory effects in LS-174 cells are mediated by the EGFR signaling system, which was likely activated by AR.

Synergy between PGE2 and Major Oncogenic Pathways.

Malignant transformation of cells is an extremely complex process and involves a number of oncogenic signaling pathways, where cross-communication often occurs. TGF-α plays critical roles in colorectal carcinogenesis and often acts through an autocrine loop (16) . Because both PGE2 and TGF-α may exert tumor-promoting effects to colon cancer cells, we sought to determine whether PGE2 and TGF-α act in a cooperative manner. As demonstrated in Fig. 5A ⇓ , both PGE2 and TGF-α induced the levels of pAkt and pCREB; however, combined treatment with PGE2 and TGF-α resulted in a marked induction of PI3K activity and CREB activation. Next, we investigated whether PGE2 and TGF-α cooperatively induced AR transcription. LS-174 cells were transfected with pGL2-A and then treated with TGF-α or PGE2 plus TGF-α. TGF-α increased only luciferase activity ∼2-fold; PGE2 increased AR promoter activity ∼7-fold. However, the combination of PGE2 and TGF-α increased luciferase activity ∼17-fold, suggesting that PGE2 and TGF-α synergistically activated the AR promoter. To demonstrate that the synergistic transcription of AR resulted from PGE2 and TGF-α treatment produced transcripts, we used real-time PCR to determine the expression of AR mRNA. PGE2 and TGF-α synergistically increased the levels of AR mRNA (Fig. 5C) ⇓ . Interestingly, a stronger synergy was observed at 24 h after PGE2 and TGF-α treatment, although PGE2 alone had no significant effect on AR expression at this time point.

Fig. 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 5.

Synergy between PGE2 and oncogenic pathways. A, PGE2 and TGF-α induction of pCREB and pAkt. LS-174 cells were serum deprived for 48 h before the indicated treatment. E2, PGE2 (0.1 μm); α, TGF-α (100 ng/ml). Protein lysates were extracted after a 2-h incubation and subjected to Western analysis for pAkt and pCREB. Results shown are representative of three separate experiments. B, synergistic induction of AR transcription by PGE2 and TGF-α. LS-174 cells were transiently transfected with pGL2-A and treated with vehicle (V), PGE2 (E2), TGF-α (α), or both PGE2 and TGF-α. Firefly and Renilla luciferase activities were measured, and firefly luciferase values were standardized to Renilla values. Plotted is the mean of assays performed in quadruplicate; bars, SD. ∗, P < 0.05. Results were similar in five independent experiments. C, synergistic induction of AR mRNA by PGE2 and TGF-α in LS-174 cells. LS-174 cells were subjected to the indicated treatment (V, vehicle; E2, 0.1 μm PGE2; α, 100 ng/ml TGF-α). mRNA was used as a template for a real-time RT-PCR assay to measure relative levels of AR expression. ∗, P < 0.05. Results were similar in two independent experiments. D, synergistic induction of AR mRNA by PGE2 and TGF-α in 293 cells. Human 293 cells were subjected to the indicated treatment (V, vehicle; E2, 0.1 μm PGE2; α, 100 ng/ml TGF-α). mRNA was used as a template for a real-time RT-PCR assay to measure relative levels of AR expression. ∗, P < 0.05. Results were similar in two independent experiments. E, synergistic induction of AR transcription by PGE2 and K-Ras. LS-174 cells were cotransfected with pGL2-A and pcDNA-3/K-RasVal12 (K) or pGL2-A and empty pcDNA-3 vector (V). Cells were serum deprived for 24 h before a 6-h PGE2 treatment. Firefly and Renilla luciferase activities were measured, and firefly luciferase values were standardized to Renilla values. Plotted is the mean of assays performed in quadruplicate; bars, SD. ∗, P < 0.05. Results were similar in four independent experiments.

COX-2/PGE2 may exert pro-oncogenic effects on a variety of tumor types (17) ; therefore, it was critical to determine whether this synergistic effect also occurred in other cell types. Both PGE2 and TGF-α slightly increased the expression of AR mRNA in human kidney 293 cells; however, in combination, PGE2 and TGF-α synergistically induced the expression of AR mRNA (Fig. 5D) ⇓ .

The K-Ras oncogene plays a key role during the adenoma-to-carcinoma sequence of events involved in the neoplastic transformation of colonic epithelial cells. We found that PGE2 and K-Ras also induced AR transcription in a synergistic manner (Fig. 5E) ⇓ . Ectopic expression of K-RasVal12 increased AR promoter activity ∼6-fold compared with empty vector-transfected LS-174 cells. PGE2 treatment increased luciferase activity ∼7-fold in vector-transfected cells; however, a 27-fold increase was observed in K-RasVal12-transfected cells that were treated with PGE2.

Discussion

cAMP-dependent PKA consists of two isozymes, type I and type II, which are distinguished by their regulatory subunits (RI and RII). Increased expression of the type Iα regulatory subunit (RIα) has been correlated to the growth of an array of tumor cells including colon cancer cells (13) . The ratio of RI to RII is significantly elevated in human colorectal carcinomas (18) . The LS-174 cell line contains mainly type I PKA and is an excellent model for investigation of pro-oncogenic roles of the cAMP/PKA pathway (19) . Treatment with RIα antisense oligonucleotide inhibits the growth of LS-174 cells (13) . Results from this study demonstrated that PGE2 signaled through the Gs-coupled EP receptor and increased the activity of the cAMP/PKA pathway, which was essential for PGE2 growth-stimulatory activity. We show that AR, an EGFR ligand, was up-regulated by PGE2-induced cAMP/PKA activity and was a mediator for the PGE2 growth-stimulatory effect in LS-174 cells. Thus, our results establish a link between three crucial proneoplastic signaling systems, the COX-2/PGE2 pathway, the cAMP/PKA pathway, and the EGFR signaling system, where AR plays a central role. In this model, COX-2-generated PGE2 stimulates PKA activation through RIα; increased PKA activity induces the transcription of AR, which then activates RTK signaling pathways and stimulates proliferation and growth of colorectal carcinoma cells. Previous studies show that genetic disruption of either COX-2 or EP2 receptor decreases the number and size of intestinal polyps in ApcΔ716 mice (20) . Tumor cell proliferation is significantly inhibited in adenomas of COX-2-deficient ApcΔ716 mice. These findings indicate the potential link between COX-2, PKA, and tumor cell proliferation in vivo. COX-2/PGE2-promoted tumor angiogenesis is thought to be one of the underlying mechanisms. Additional experiments are required to determine the roles of RTK in these animal models.

Our studies demonstrate that in response to PGE2 treatment, the expression of AR is significantly increased in LS-174 cells. Cumulative evidence suggests that AR exerts tumor-promoting effects on colorectal carcinomas. AR mRNA is expressed in 60–70% of primary and metastatic human colorectal carcinomas but in only 2–7% of normal human colonic mucosa (21) . AR plays critical roles in colon cancer cell proliferation and transformation that are required for the growth of human colon carcinoma xenografts (14) . In agreement with these studies, we found that AR stimulated the proliferation and growth of LS-174 cells and mediated the PGE2-induced growth stimulation of colon cancer cells.

The CRE consists of an 8-bp palindrome (TGACGTCA) and is typically found within 100 nucleotides of the TATA box. Although the CRE is conserved in the AR promoter, thus far, the role of the CRE in the regulation of AR transcription is not completely understood (15) . Wilms tumor suppressor transcription factor (WT1) activates the CRE in the AR promoter through an undefined mechanism in human osteosarcoma cells (12) . Here, we show that the CRE is critical for the PGE2-induced transcriptional activation of AR in LS-174 cells. CRE sites are frequently located adjacent to other regulatory elements, such as Sp1. Several Sp1 sequences are found adjacent to the CRE of the AR promoter, and their functional roles are under investigation. These results suggest that genes that contain an active CRE site in their promoter may be potentially regulated by PGE2. Further identifying PGE2/PKA target genes and their functional roles will contribute to the understanding of the molecular pathway of colorectal carcinogenesis.

The mechanisms by which GPCR transactivates RTK signaling pathways are complex. It was shown that PGE2-mediated transactivation of EGFR and downstream signaling involves TGF-α, an EGFR ligand, which is likely released by the c-Src-activated matrix metalloproteinase pathway (4) . In the present study, we demonstrate that PGE2 activated EGFR through induction of AR expression. Apparently, PGE2 may target multiple EGF family members through different mechanisms in colon cancer cells. The PI3K/Akt pathway acts as a transducer of input initiated by growth factor receptors and plays critical roles in the growth and transformation of colorectal carcinoma cells (22) . We have reported that the PGE2 growth-stimulatory effect on LS-174 cells is dependent on PI3K activity (6) . Results from this study demonstrate that PGE2-induced PI3K activation was dependent on EGFR tyrosine kinase activity, which was likely activated by PGE2-induced autocrine AR.

Although it is now clear that COX-2 plays an important role in the promotion of colorectal cancer (1) , COX-2 is not defined as an oncogene. In previous studies (5 , 6) , we have demonstrated that PGE2 activates oncogenic signaling pathways and enhances transformed phenotypes including cell proliferation, motility, and morphogenesis. In the present study, we show that PGE2, in conjunction with TGF-α and the K-Ras oncogene, synergistically induced AR transcription and stimulated the activation of PKA and PI3K. These results suggest that PGE2 alone may exert temporary effects on tumor cells; however, in combination with other oncogenic signaling pathways, PGE2 may play a key role in neoplastic transformation. To our knowledge, this study is the first to demonstrate that PGE2 acts with major oncogenic signaling pathways in a synergistic manner, thus providing additional insight into the mechanisms by which COX-2/PGE2 promotes colorectal carcinogenesis.

In conclusion, our results link the COX-2/PGE2 pathway to the pro-oncogenic cAMP/PKA pathway and the oncogenic EGFR signaling system, where an EGFR ligand, AR, serves as a central mediator. AR is up-regulated by the PGE2/cAMP/PKA pathway and, in turn, activates EGFR tyrosine kinases that transduce mitogenic signals and stimulate the growth of colorectal carcinoma cells. Future studies are aimed at the transcriptional regulation of gene expression through the PGE2/PKA/CRE pathway and the synergistic cooperation between PGE2 and major oncogenic pathways, which will be critical for the understanding of COX-2 proneoplastic activity in colorectal carcinogenesis.

Acknowledgments

We thank Dr. Raymond N. DuBois for valuable comments on the manuscript and Dr. Kevin Knudtson (University of Iowa) for performing Affymetrix GeneChip Assays.

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • ↵1 Supported by the John Sealy Memorial Endowment Fund for Biomedical Research and the Gastrointestinal Research Interdisciplinary Program (both to H. S.).

  • ↵2 To whom requests for reprints should be addressed, at Department of Surgery, The University of Texas Medical Branch, Galveston, TX 77555. Phone: (409) 772-6661; E-mail: hosheng{at}utmb.edu

  • ↵3 The abbreviations used are: COX, cyclooxygenase; PG, prostaglandin; GPCR, G protein-coupled receptor; Gs, stimulatory G; cAMP, cyclic AMP; EGF, epidermal growth factor; EGFR, EGF receptor; RTK, receptor tyrosine kinase; PI3K, phosphatidylinositol 3-kinase; AR, amphiregulin; PKA, protein kinase A; CRE, cAMP-responsive element; CREB, CRE binding; RT-PCR, reverse transcription-PCR; TGF, transforming growth factor.

  • Received March 18, 2003.
  • Revision received June 26, 2003.
  • Accepted July 11, 2003.
  • ©2003 American Association for Cancer Research.

References

  1. ↵
    Williams C. S., Mann M., DuBois R. N. The role of cyclooxygenases in inflammation, cancer, and development. Oncogene, 18: 7908-7916, 1999.
    OpenUrlCrossRefPubMed
  2. ↵
    Breyer M. D., Breyer R. M. Prostaglandin receptors: their role in regulating renal function. Curr. Opin. Nephrol. Hypertens., 9: 23-29, 2000.
    OpenUrlCrossRefPubMed
  3. ↵
    Reinhart W. H., Muller O., Halter F. Influence of long-term 16,16-dimethyl prostaglandin E2 treatment on the rat gastrointestinal mucosa. Gastroenterology, 85: 1003-1010, 1983.
    OpenUrlPubMed
  4. ↵
    Pai R., Soreghan B., Szabo I. L., Pavelka M., Baatar D., Tarnawski A. S. Prostaglandin E2 transactivates EGF receptor: a novel mechanism for promoting colon cancer growth and gastrointestinal hypertrophy. Nat. Med., 8: 289-293, 2002.
    OpenUrlCrossRefPubMed
  5. ↵
    Sheng H., Shao J., Morrow J. D., Beauchamp R. D., DuBois R. N. Modulation of apoptosis and Bcl-2 expression by prostaglandin E2 in human colon cancer cells. Cancer Res., 58: 362-366, 1998.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Sheng H., Shao J., Washington M. K., DuBois R. N. Prostaglandin E2 increases growth and motility of colorectal carcinoma cells. J. Biol. Chem., 276: 18075-18081, 2001.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Oldham S. M., Cox A. D., Reynolds E. R., Sizemore N. S., Coffey R. J. J., Der C. J. Ras, but not Src, transformation of RIE-1 epithelial cells is dependent on activation of the mitogen-activated protein kinase cascade. Oncogene, 16: 2565-2573, 1998.
    OpenUrlCrossRefPubMed
  8. ↵
    Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell, 103: 211-225, 2000.
    OpenUrlCrossRefPubMed
  9. ↵
    Luttrell L. M., Daaka Y., Lefkowitz R. J. Regulation of tyrosine kinase cascades by G-protein-coupled receptors. Curr. Opin. Cell Biol., 11: 177-183, 1999.
    OpenUrlCrossRefPubMed
  10. ↵
    Reese J., Das S. K., Paria B. C., Lim H., Song H., Matsumoto H., Knudtson K. L., DuBois R. N., Dey S. K. Global gene expression analysis to identify molecular markers of uterine receptivity and embryo implantation. J. Biol. Chem., 276: 44137-44145, 2001.
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Shao J., Sheng H., Inoue H., Morrow J. D., DuBois R. N. Regulation of constitutive cyclooxygenase-2 expression in colon carcinoma cells. J. Biol. Chem., 275: 33951-33956, 2000.
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Lee S. B., Huang K., Palmer R., Truong V. B., Herzlinger D., Kolquist K. A., Wong J., Paulding C., Yoon S. K., Gerald W., Oliner J. D., Haber D. A. The Wilms tumor suppressor WT1 encodes a transcriptional activator of amphiregulin. Cell, 98: 663-673, 1999.
    OpenUrlCrossRefPubMed
  13. ↵
    Yokozaki H., Budillon A., Tortora G., Meissner S., Beaucage S. L., Miki K., Cho-Chung Y. S. An antisense oligodeoxynucleotide that depletes RIα subunit of cyclic AMP-dependent protein kinase induces growth inhibition in human cancer cells. Cancer Res., 53: 868-872, 1993.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    De Luca A., Arra C., D’Antonio A., Casamassimi A., Losito S., Ferraro P., Ciardiello F., Salomon D. S., Normanno N. Simultaneous blockage of different EGF-like growth factors results in efficient growth inhibition of human colon carcinoma xenografts. Oncogene, 19: 5863-5871, 2000.
    OpenUrlCrossRefPubMed
  15. ↵
    Plowman G. D., Green J. M., McDonald V. L., Neubauer M. G., Disteche C. M., Todaro G. J., Shoyab M. The amphiregulin gene encodes a novel epidermal growth factor-related protein with tumor-inhibitory activity. Mol. Cell. Biol., 10: 1969-1981, 1990.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Gangarosa L. M., Sizemore N., Graves-Deal R., Oldham S. M., Der C. J., Coffey R. J. A raf-independent epidermal growth factor receptor autocrine loop is necessary for Ras transformation of rat intestinal epithelial cells. J. Biol. Chem., 272: 18926-18931, 1997.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Turini M. E., DuBois R. N. Cyclooxygenase-2: a therapeutic target. Annu. Rev. Med., 53: 35-57, 2002.
    OpenUrlCrossRefPubMed
  18. ↵
    Bradbury A. W., Carter D. C., Miller W. R., Cho-Chung Y. S., Clair T. Protein kinase A (PK-A) regulatory subunit expression in colorectal cancer and related mucosa. Br. J. Cancer, 69: 738-742, 1994.
    OpenUrlPubMed
  19. ↵
    Ally S., Tortora G., Clair T., Grieco D., Merlo G., Katsaros D., Ogreid D., Doskeland S. O., Jahnsen T., Cho-Chung Y. S. Selective modulation of protein kinase isozymes by the site-selective analog 8-chloroadenosine 3′,5′-cyclic monophosphate provides a biological means for control of human colon cancer cell growth. Proc. Natl. Acad. Sci. USA, 85: 6319-6322, 1988.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Sonoshita M., Takaku K., Sasaki N., Sugimoto Y., Ushikubi F., Narumiya S., Oshima M., Taketo M. M. Acceleration of intestinal polyposis through prostaglandin receptor EP2 in Apc(Δ716) knockout mice. Nat. Med., 7: 1048-1051, 2001.
    OpenUrlCrossRefPubMed
  21. ↵
    Ciardiello F., Kim N., Saeki T., Dono R., Persico M. G., Plowman G. D., Garrigues J., Radke S., Todaro G. J., Salomon D. S. Differential expression of epidermal growth factor-related proteins in human colorectal tumors. Proc. Natl. Acad. Sci. USA, 88: 7792-7796, 1991.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    Nguyen K. T., Wang W. J., Chan J. L., Wang L. H. Differential requirements of the MAP kinase and PI3 kinase signaling pathways in Src versus insulin and IGF-1 receptors-induced growth and transformation of rat intestinal epithelial cells. Oncogene, 19: 5385-5397, 2000.
    OpenUrlCrossRefPubMed
View Abstract
PreviousNext
Back to top
Cancer Research: 63 (17)
September 2003
Volume 63, Issue 17
  • Table of Contents
  • About the Cover

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Research article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Prostaglandin E2 Stimulates the Growth of Colon Cancer Cells via Induction of Amphiregulin
(Your Name) has forwarded a page to you from Cancer Research
(Your Name) thought you would be interested in this article in Cancer Research.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Prostaglandin E2 Stimulates the Growth of Colon Cancer Cells via Induction of Amphiregulin
Jinyi Shao, Sean B. Lee, Huiping Guo, B. Mark Evers and Hongmiao Sheng
Cancer Res September 1 2003 (63) (17) 5218-5223;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Prostaglandin E2 Stimulates the Growth of Colon Cancer Cells via Induction of Amphiregulin
Jinyi Shao, Sean B. Lee, Huiping Guo, B. Mark Evers and Hongmiao Sheng
Cancer Res September 1 2003 (63) (17) 5218-5223;
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and Methods
    • RESULTS
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Recombinant Listeria Vaccines Containing PEST Sequences Are Potent Immune Adjuvants for the Tumor-Associated Antigen Human Papillomavirus-16 E7
  • Granulocyte-Macrophage Colony-Stimulating Factor and Interleukin-2 Fusion cDNA for Cancer Gene Immunotherapy
  • 2-Arachidonoylglycerol
Show more Advances in Brief
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook  Twitter  LinkedIn  YouTube  RSS

Articles

  • Online First
  • Current Issue
  • Past Issues
  • Meeting Abstracts

Info for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Cancer Research

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Cancer Research Online ISSN: 1538-7445
Cancer Research Print ISSN: 0008-5472
Journal of Cancer Research ISSN: 0099-7013
American Journal of Cancer ISSN: 0099-7374

Advertisement