Skip to main content
  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

AACR logo

  • Register
  • Log in
  • Log out
  • My Cart
Advertisement

Main menu

  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Focus on Computer Resources
      • Highly Cited Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Early Career Award
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citations
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

  • AACR Publications
    • Blood Cancer Discovery
    • Cancer Discovery
    • Cancer Epidemiology, Biomarkers & Prevention
    • Cancer Immunology Research
    • Cancer Prevention Research
    • Cancer Research
    • Clinical Cancer Research
    • Molecular Cancer Research
    • Molecular Cancer Therapeutics

User menu

  • Register
  • Log in
  • Log out
  • My Cart

Search

  • Advanced search
Cancer Research
Cancer Research
  • Home
  • About
    • The Journal
    • AACR Journals
    • Subscriptions
    • Permissions and Reprints
    • Reviewing
  • Articles
    • OnlineFirst
    • Current Issue
    • Past Issues
    • Meeting Abstracts
    • Collections
      • COVID-19 & Cancer Resource Center
      • Focus on Computer Resources
      • Highly Cited Collection
      • Editors' Picks
      • "Best of" Collection
  • For Authors
    • Information for Authors
    • Author Services
    • Early Career Award
    • Best of: Author Profiles
    • Submit
  • Alerts
    • Table of Contents
    • Editors' Picks
    • OnlineFirst
    • Citations
    • Author/Keyword
    • RSS Feeds
    • My Alert Summary & Preferences
  • News
    • Cancer Discovery News
  • COVID-19
  • Webinars
  • Search More

    Advanced Search

Experimental Therapeutics

Small Interfering RNA-induced Suppression of MDR1 (P-Glycoprotein) Restores Sensitivity to Multidrug-resistant Cancer Cells

Hao Wu, William N. Hait and Jin-Ming Yang
Hao Wu
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
William N. Hait
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jin-Ming Yang
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI:  Published April 2003
  • Article
  • Info & Metrics
  • PDF
Loading

Abstract

Overexpression of P-glycoprotein (P-gp), the MDR1 gene product, confers multidrug resistance (MDR) to cancer cells. Clinically, MDR is one of the major causes for chemotherapeutic treatment failure in cancer patients. To explore a new approach to circumventing MDR, we adopted RNA interference to target MDR1 gene expression. RNA interference is a conserved biological response to double-stranded RNA, which results in sequence-specific gene silencing [G. J. Hannon, Nature (Lond.), 418: 244–251, 2002]. We report that introduction of an MDR1-targeted small interfering RNA duplex into drug-resistant cancer cells markedly inhibited the expression of MDR1 mRNA and P-gp, as determined by reverse transcription-PCR and Western blot. Inhibition of P-gp expression by small interfering RNA enhanced the intracellular accumulation of and selectively restored sensitivity to drugs transported by P-gp. These studies indicate that RNA interference can modulate MDR in preclinical models.

INTRODUCTION

Drug resistance hampers successful chemotherapy in cancer patients. One form of MDR 3 is caused by overexpression of P-gp, the MDR1 gene product (1 , 2) . P-gp is a transmembrane phosphoglycoprotein capable of transporting a variety of structurally and functionally diverse chemotherapeutic drugs such as vinblastine, doxorubicin, and paclitaxel, leading to reduced intracellular drug concentration and decreased cytotoxicity (3) . Despite promising early studies showing that P-gp antagonists could reverse MDR (4, 5, 6, 7) , the clinical goal of restoring drug sensitivity to drug-resistant human cancer has been elusive. Successful reversal or prevention of drug resistance is still awaiting new therapeutic strategies or pharmaceuticals. In this study, we tested the feasibility of using siRNA to inhibit P-gp expression and reverse MDR. siRNA generated from double-stranded RNA can trigger silencing of homologous gene expression by inducing degradation of the complementary mRNA, an evolutionarily conserved mechanism termed RNA interference or post-transcriptional gene silencing (8 , 9) . Using the RNA interference approach, we show that the expression of the endogenous as well as transfected MDR1 gene can be effectively inhibited, and that the sensitivity to P-gp-transportable drugs can be restored. Our study demonstrates the utility of siRNA for therapeutically modulating P-gp-mediated drug resistance.

MATERIALS AND METHODS

Cell Lines and Culture.

The MDR human breast cancer cell lines, MCF-7/AdrR and MCF-7/BC-19, and their parental, sensitive line, MCF-7, were kindly supplied by Dr. Kenneth Cowan of the Eppley Institute for Research in Cancer (Omaha, NE). They were maintained in RPMI 1640 containing 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin at 37°C in a humidified atmosphere containing 5% CO2/95% air. MCF-7/AdrR was developed by step-wise selection (10) , and MCF-7/BC-19 is a MDR1 transfectant (11) . Human ovarian carcinoma cell lines, A2780 and A2780Dx5, were provided by Dr. Youcef Rustum (Roswell Park Cancer Institute, Buffalo, NY) and were grown in DMEM containing 10% fetal bovine serum under the identical condition as described above except that for A2780Dx5, 2 μm of doxorubicin was added to the medium for the maintenance of the MDR phenotype (12) . Cells were checked routinely and found to be free of contamination by Mycoplasma or fungi. All of the cell lines were discarded after 3 months and new lines obtained from frozen stocks.

siRNA Preparation and Transfection.

The siRNA sequence targeting MDR1 corresponded to the coding region 79–99 (5′-AAGGAAAAGAAACCAACTGTC-3′) relative to the start codon. The siRNA duplex with the following sense and antisense sequences was used: 5′-GGAAAAGAAACCAACUGUCdTdT (sense) and dTdTCCUUUUCUUUGGUUGACAG-5′ (antisense). Lamin A/C siRNA duplex has the following sequences: 5′-CUGGACUUCCAGAAGAACAdTdT (sense) and dTdTGACCUGAAGGUCUUCUUGU-5′ (antisense).

All of the siRNA duplexes were synthesized by Dharmacon Research, Inc. (Lafayette, CO) using 2′-ACE protection chemistry.

Cells in exponential phase of growth were plated in six-well plates at 5 × 105 cells/well, grown for 24 h then transfected with siRNA (P-gp siRNA: 200 nm; lamin A/C siRNA: 100 nm) using oligofectamine and OPTI-MEM I reduced serum medium (Invitrogen Life Technologies, Inc., Carlsbad, CA), according to the manufacturer’s protocol. The concentrations of siRNAs were chosen based on dose-response studies. Silencing was examined 24–48 h after transfection. Control cells were treated with oligofectamine and serum-reduced medium (mock).

Reverse Transcription-PCR.

Total RNA was extracted from cells with TRIzol reagent (Invitrogen Life Technologies, Inc.) and quantified by UV absorbance spectroscopy. The reverse transcription reaction was performed using the Superscript First-Strand Synthesis System (Invitrogen Life Technologies, Inc.) in a final volume of 20 μl containing 5 μg of total RNA, 200 ng of random hexamers, 1× reverse transcription buffer, 2.5 mm MgCl2, 1 mm deoxynucleotide triphosphate mixture, 10 mm DTT, RNaseOUT recombinant ribonuclease inhibitor, 50 units of Superscript reverse transcriptase, and diethylpyrocarbonate-treated water. After incubation at 42°C for 80 min, the reverse transcription reaction was terminated by heating at 70°C for 15 min. The newly synthesized cDNA was amplified by PCR. The reaction mixture contained 2 μl of cDNA template, 1.5 mm MgCl2, 2.5 units of Tag polymerase, and 0.5 μm of MDR1 primer (5′-ATATCAGCAGCCCACATCAT-3′; 5′-GAAGCACTGGGATGTCCGGT-3′; Ref. 13 ). GAPDH primer (5′-GCCAAAAGGGTCATCATCTC-3′; 5′-GTAGAGGCAGGGATGATGTTC-3′) was used as an internal control. Amplication cycles were: 94°C for 3 min, then 33 cycles at 94°C for 1 min, 58°C for 1 min, 72°C for 1.5 min, followed by 72°C for 15 min. Aliquots of PCR product were electrophoresed on 1.5% agarose gels, and PCR fragments were visualized by ethidium bromide staining.

Western Blot Analysis.

Cells were washed twice with PBS containing 1 mm phenylmethylsulphonyl fluoride, scraped off the dishes, and pelleted at 500 × g for 10 min. Cell pellets were then lysed in cold TNT buffer [20 mm Tris-HCl (pH 7.4), 200 mm NaCl, 1% Triton X-100, 1 mm phenylmethylsulphonyl fluoride, and 1% aprotinin) for 45 min with occasional rocking. The lysates were transferred to Eppendorf tubes and clarified by centrifugation at 12,000 × g for 40 min at 4°C. Identical amounts (50 μg of protein) of cell lysates were resolved by 8% SDS-PAGE. Transfer of proteins to nitrocellulose was carried out by the method of Towbin et al. (14) . The membranes were incubated in blocking solution consisting of 5% powered milk in TBST [10 mm Tris-HCl (pH 8.0), 150 mm NaCl, and 0.1% Tween 20] at room temperature for 1 h, then immunoblotted with monoclonal anti-P-gp antibody C219 (Calbiochem, San Diego, CA), antilamin A/C antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), or antitubulin antibody (Sigma-Aldrich, St. Louis, MO). Detection by enzyme-linked chemiluminescence was performed according to the manufacturer’s protocol (ECL; Amersham Pharmacia Biotech, Piscataway, NJ). Protein expression was quantified by Molecular Analyst software (Bio-Rad Laboratories, Hercules, CA).

Paclitaxel and Doxorubicin Accumulation.

Steady-state paclitaxel accumulation was assayed by a method described previously by our laboratory (15) . Briefly, sensitive and MDR MCF-7 cells transfected with siRNA or mock were seeded in 24-well plates and grown for 48 h. Then, the growth medium was aspirated and replaced with 0.25 ml of RPMI 1640 containing 25 mm HEPES (pH 7.4) and 50 nm of [3H]paclitaxel (10.0 Ci/mmol; Moravek Biochemicals, Inc., Brea, CA). Cells were incubated with [3H]paclitaxel for 2 h and were then cooled on ice, washed three times with ice-cold PBS, and solubilized with 0.25 ml of 1% SDS. The radioactivity in each sample was determined by scintillation counting.

To assess steady-state doxorubicin accumulation, sensitive and MDR MCF-7 cells transfected with siRNA or mock were incubated with 25 μm of doxorubicin for 1 (sensitive MCF-7) or 2 h (MCF-7/AdrR). At the end of incubation, cells were washed three times with PBS and observed under a fluorescence microscope with 100× lens (Nikon ECLIPSE TE200 microscope; Nikon Inc., Melville, NY).

Clonogenic Assay.

siRNA-transfected cells were plated in 60-mm cell culture dishes (250 cells/dish) and incubated at 37°C in a humidified atmosphere containing 5% CO2/95% air for 12 days in the presence of various concentrations of vinblastine, doxorubicin, or hydroxyurea. At the end of the incubation period, cells were stained with 1% methylene blue in 50% methanol for 30 min, washed with water, and colonies counted. IC50 was defined as the concentration of drug that inhibited colony formations by 50% as compared with that of vehicle-treated control. Student’s t test was used to determine the degree of significance. Fold reversal was the IC50 for cytotoxic drug in mock-treated cells divided by the IC50 for drug in siRNA-treated cells.

RESULTS

To test whether siRNA could be used to modulate MDR, we treated MDR cells overexpressing P-gp with an siRNA duplex designed to target coding region 79–99 after the start codon of MDR1. Fig. 1 ⇓ shows that as compared with mock transfection, the siRNA duplex reduced the levels of the endogenous (Fig. 1A) ⇓ as well as the transfected (Fig. 1B) ⇓ MDR1 mRNA in drug-resistant cells at 24 and 48 h after treatment, as determined by reverse transcription-PCR. The siRNA had no effect on GAPDH RNA (Fig. 1) ⇓ .

Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1.

Effect of siRNA on MDR1 mRNA expression in MDR cancer cells. MDR MCF-7 and A2780 (A) or MCF-7/BC-19 (B) cells were treated with 200 nm of MDR1 siRNA or mock, which only consisted of oligofectamine and OPTI-MEM I reduced serum medium. Twenty-four and 48 h later, total RNA was extracted from the cells and the reverse transcription reaction was performed using the Superscript First-Strand Synthesis System (Invitrogen Life Technologies, Inc.). The newly synthesized MDR1 cDNA was amplified by PCR using the MDR1 primer (5′-ATATCAGCAGCCCACATCAT-3′; 5′-GAAGCACTGGGATGTCCGGT-3′). GAPDH primer (GCCAAAAGGGTCATCATCTC; GTAGAGGCAGGGATGATGTTC) was used as an internal control. Aliquots of PCR product were electrophoresed on 1.5% agarose gels, and PCR fragments were visualized by ethidium bromide staining. Results are the representative of three similar experiments.

To determine the effect of siRNA on target protein expression, cell lysates from the treated cells were analyzed by Western blot. Fig. 2A ⇓ demonstrates that the expression of P-gp was decreased by 24 h in all three of the cell lines. The P-gp content remained lower in siRNA-treated A2780Dx5 and MCF-7/BC-19 cell lines at 48 h after treatment as compared with the controls. However, the protein level began to increase in MCF-7/AdrR cells 48 h after treatment (Fig. 2A) ⇓ . MDR1 siRNA did not affect α-tubulin expression (Fig. 2A) ⇓ . To confirm the specificity of the siRNA-mediated silencing of P-gp expression, we tested an unrelated sequence, lamin A/C siRNA (16) , on gene expression. Fig. 2B ⇓ demonstrates that treatment of P-gp-overexpressing MDR cells with lamin A/C siRNA reduced the expression of lamin A protein but had no effect on the expression of P-gp.

Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2.

Effect of siRNA on P-gp expression in MDR cancer cells. MDR MCF-7 and A2780 cells were treated with 200 nm of MDR1 siRNA, 100 nm of lamin A/C siRNA, or mock. Twenty-four and 48 h later, cell lysates were prepared from the siRNA- or mock-treated cells. Equal amounts (50 μg proteins) of cell lysates were separated by 8% SDS-PAGE, then transferred onto nitrocellulose membrane. The membranes were immunoblotted with monoclonal anti-P-gp antibody C219, antilamin A/C antibody, or antitubulin antibody. Detection of P-gp was performed using enzyme-linked chemiluminescence. Protein expression was quantified by Molecular Analyst software. Results are the representative of three similar experiments.

Treatment of cells with the siRNA enhanced intracellular drug accumulation. Fig. 3A ⇓ shows that in siRNA-treated MCF-7/AdrR cells, the accumulation of paclitaxel, a P-gp-transportable compound, was increased significantly as compared with that of the mock-transfected cells (P < 0.01). The accumulation of doxorubicin, another drug that is transported by P-gp, was also increased in the siRNA-treated MDR MCF-7 cells in comparison with the mock-transfected controls (Fig. 3B) ⇓ .

Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3.

Effect of siRNA on accumulation of paclitaxel and doxorubicin in MDR cancer cells. A, sensitive and MDR MCF-7 cells treated with MDR1 siRNA or mock were seeded in 24-well plates and grown for 48 h. Cells were then incubated with 50 nm [3H]paclitaxel for 2 h at 37°C. At the end of incubation, cells were cooled on ice, washed three times with ice-cold PBS, and solubilized with 0.25 ml of 1% SDS. The radioactivity in each sample was determined by scintillation counting. Bar, ± SD of triplicate determinations. B. siRNA- or mock-transfected MDR MCF-7 and sensitive MCF-7 cells were treated with 25 μm of doxorubin for 1 (sensitive MCF-7) or 2 h (MCF-7/AdrR). At the end of incubation, cells were washed three times with PBS, then observed under a fluorescence microscope with ×100 lens. Results are the representative of two similar experiments.

To assess whether siRNA-directed suppression of P-gp sensitized MDR cancer cells to cytotoxic agents, we compared the drug sensitivity of the siRNA-treated to that of the mock-treated MDR cells using clonogenic assay. As shown in Table 1 ⇓ and Fig. 4 ⇓ , the sensitivity of the MDR cells to vinblastine, doxorubicin, and paclitaxel was increased significantly by the introduction of MDR1-targeted siRNA (P < 0.05). For example, in MCF-7/AdrR, MCF-7/BC-19, and A2780Dx5 cell lines, siRNA caused a 232-, 49-, and 4-fold reversal of cellular resistance to vinblastine, respectively. In MCF-7/AdrR cells, treatment with siRNA caused a 12-fold reversal of resistance to doxorubicin and 95-fold reversal of resistance to paclitaxel. The sensitivity to hydroxyurea, a drug that is not transported by P-gp, was not affected by silencing of P-gp expression (Table 1 ⇓ ; Fig. 4 ⇓ ).

Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4.

Effect of siRNA on sensitivity of MDR cancer cells to vinblastine, doxorubicin, and hydroxyurea. MDR1 siRNA- or mock-treated MCF-7/AdrR cells plated in 60-mm cell culture dishes were incubated at 37°C in a humidified atmosphere containing 5% CO2/95% air for 12 days in the presence of a series of concentrations of vinblastine, doxorubicin, or hydroxyurea. At the end of incubation, cells were stained with 1% methylene blue in 50% methanol for 30 min, washed with water, and the colony number counted. Results are the representative of two similar experiments; bars, ± SD.

View this table:
  • View inline
  • View popup
Table 1

Effect of siRNA on sensitivity of MDR cells to chemotherapeutic drugs

Cells were plated in 60-mm cell culture dishes (200 cells/dish) and exposed to various concentrations of cytotoxic drugs for 12 days. At the end of incubation, cells were stained with 1% methylene blue and the colonies counted. IC50 is the concentration that produced 50% inhibition of colony formation compared to vehicle-treated controls. Results represent the mean of two or mean ± standard error of three separate experiments.

DISCUSSION

Because Elbashir et al. (16) reported that RNA interference can be triggered in mammalian cells by introduction of 21-nucleotide siRNA, siRNA has been shown to be an effective approach for silencing gene expression that has been applied recently to inhibiting HIV-1 replication and infection in cell cultures (17, 18, 19, 20) . We now demonstrate that introduction of an siRNA duplex decreases the expression of P-gp (Fig. 2) ⇓ , increases intracellular drug accumulation (Fig. 3) ⇓ , and restores drug sensitivity (Fig. 4) ⇓ in human MDR cancer cells. We also found that the modulation of MDR results from the siRNA-directed degradation of MDR1 mRNA (Fig. 1) ⇓ .

P-gp is expressed in many human tumors either at the time of diagnosis or after treatment. Inhibition of the function or expression of P-gp can sensitize MDR cells to chemotherapeutic drugs (3 , 21) . Although modulations of MDR by pharmacological agents (3) , antibodies (22) , antisense oligonucleotides (23) , and inhibitors of signal transduction (24) have been reported, the clinical benefit of these approaches has not been realized. Gene silencing induced by RNA interference was shown to be specific and potent (16 , 25) . siRNAs target the expression of the genes from which the siRNA sequences are derived without detectable effects on the expression of unrelated genes (16 , 25) . In Caenorhabditis elegans, only a few molecules of siRNA per cell are required for silencing and the spread of the silencing effect through a broad region of the organism (25) ; a greater number of molecules per cell may be required to acquire the desired result in mammalian cells. Nevertheless, siRNA-induced RNA interference may offer an alternative strategy for overcoming drug resistance.

This report demonstrates the feasibility of using siRNA to specifically and effectively modulate MDR. MDR1-targeted siRNA inhibits the expression of MDR1 RNA and P-gp with minimum effect on GAPDH and tubulin expression in comparison with mock treatment (Fig. 1 ⇓ and Fig. 2A ⇓ ); lamin A/C siRNA decreased lamin A expression but had no effect on the expression of P-gp (Fig. 2B) ⇓ . Furthermore, MDR1-targeted siRNA reversed resistance to P-gp-transportable drugs, but did not affect the sensitivity to hydroxyurea, a non-P-gp substrate (Table 1 ⇓ ; Fig. 4 ⇓ ). These data suggest that silencing of P-gp expression mediated by siRNA is specific. Despite using the optimum concentration (200 nm) of siRNA determined by dose-response studies, the maximum inhibition of P-gp expression was 65% (Fig. 2A) ⇓ . The lack of complete inhibition is likely because of the high content of P-gp (10, 11, 12) , the relatively long half-life (14–17 h) of the protein (26) , and transfection efficiency. The incomplete inhibition of P-gp expression may explain the incomplete restoration of drug sensitivity in MCF-/AdrR and A2780Dx5 (Table 1) ⇓ , two highly resistant MDR cell lines (10) . Furthermore, because MCF-7/AdrR and A2780Dx5 are lines selected by prolonged exposure to doxorubicin, additional mechanisms of drug resistance are known to exist (12 , 27) . In contrast, siRNA was more effective against the MDR1-transfected MCF-7/BC-19 cell line, which is 10–50-fold less resistant than the MCF-7/AdrR line (11) . The effect of siRNA on drug resistance was similar to that reported for chemical modulators (3, 4, 5, 6, 7) .

Similar to several other studies using siRNA (17 , 18) , the silencing effect on P-gp expression is short-lived. The maximum decreases in MDR1 mRNA are seen at 24 h, and begin to recover 24 h later. By 72 h, the message had returned to baseline values (data not shown). As anticipated, the recovery of P-gp expression tends to lag behind that of the RNA (Fig. 2A) ⇓ . Because the half-life of P-gp is 14–17 h (26) , a greater decrease in P-gp expression may be attained through the use of a DNA vector-based siRNA expression system (28, 29, 30, 31) .

Treatment of MDR cells with P-gp siRNA increases the intracellular accumulation of paclitaxel and doxorubicin, two P-gp substrates (Fig. 3) ⇓ , enhances the sensitivity to doxorubicin, paclitaxel, and vinblastine, but has no effect on the non-P-gp transportable drug, hydroxyurea (Fig. 4 ⇓ ; Table 1 ⇓ ). Successful delivery of siRNA to postnatal and adult mice by high-pressure tail-vein injection has been reported recently (32 , 33) . Therefore, studies in animals harboring MDR tumors are warranted as precursors to testing this approach in humans.

In summary, our study demonstrates the effectiveness of siRNA in reversing MDR. Therefore, the RNA interference approach may hold promise for the treatment of drug-resistant cancer.

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

  • ↵1 Supported by grants from the United States Public Health Service National Cancer Institute CA 66077 and CA 72720.

  • ↵2 To whom requests for reprints should be addressed, at The Cancer Institute of New Jersey, University of Medicine and Dentistry of New Jersey/Robert Wood Johnson Medical School, 195 Little Albany Street, New Brunswick, NJ 08901. Phone: (732) 235-8075; Fax: (732) 235-8098; E-mail address: jyang{at}umdnj.edu (to J-M. Y.) and haitwn{at}umdnj.edu (to W. N. H.).

  • ↵3 The abbreviations used are: MDR, multidrug resistant or multidrug resistance; P-gp, P-glycoprotein; siRNA, small interfering RNA; GAPDH, glyceraldehydes-3-phosphate dehydrogenase.

  • Received October 25, 2002.
  • Accepted February 18, 2003.
  • ©2003 American Association for Cancer Research.

References

  1. ↵
    Ling V. Multidrug resistance and P-glycoprotein expression. Ann. N. Y. Acad. Sci., 507: 7-8, 1987.
    OpenUrlPubMed
  2. ↵
    Roninson I. B., Chin J. E., Choi K. G., Gros P., Housman D. E., Fojo A., Shen D. W., Gottesman M. M., Pastan I. Isolation of human mdr DNA sequences amplified in multidrug-resistant KB carcinoma cells. Proc. Natl. Acad. Sci. USA, 83: 4538-4542, 1986.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    Ford J. M., Hait W. N. Pharmacology of drugs that alter multidrug resistance in cancer. Pharmacol. Rev., 42: 155-199, 1990.
    OpenUrlPubMed
  4. ↵
    Yahanda A. M., Adler K. M., Fisher G. M., Brophy N. A., Halsy J., Hardy R. I., Gosland M. P., Lum B. L., Sikic B. I. Phase I trial of etoposide with cyclosporine as a modulator of multidrug resistance. J. Clin. Oncol., 10: 1624-1634, 1992.
    OpenUrlAbstract/FREE Full Text
  5. ↵
    Dalton W. S., Grogan T. M., Meltzer P. S., Scheper R. J., Durie B. G. M., Taylor C. W., Miller T. P., Salmon S. E. Drug-resistance in multiple myeloma and nonHodgkin’s lymphoma: detection of P-glycoprotein and potential circumvention by addition of verapamil to chemotherapy. J. Clin. Oncol., 7: 415-424, 1989.
    OpenUrlAbstract
  6. ↵
    Sonneveld P., Durie B. G. M., Lokhurst H. M., Marie J. P., Solbu B., Suciu S., Zittoun R., Lowenberg B., Nooter K. Modulation of multidrug-resistant multiple myeloma by cyclosporin. Lancet, 340: 255-259, 1992.
    OpenUrlCrossRefPubMed
  7. ↵
    Hait W. N., Stein J. M., Koletsky A. J., Harding M. W., Handschumacher R. E. Activity of cyclosporin A and a non-immunosuppressive cyclosporin against multidrug resistant leukemic cell lines. Cancer Commun., 1: 35-43, 1989.
    OpenUrlPubMed
  8. ↵
    Hannon G. J. RNA interference. Nature (Lond.), 418: 244-251, 2002.
    OpenUrlCrossRefPubMed
  9. ↵
    Tuschl T., Zamore P. D., Lehmann R., Bartel D. P., Sharp P. A. Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev., 13: 3191-3197, 1999.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Cohen J. S., Lyon R. C., Chen C., Faustino P. J., Batist G., Shoemaker M., Rubalcaba E., Cowan K. H. Differences in phosphate metabolite levels in drug-sensitive and -resistant human breast cancer cell lines determined by 31P magnetic resonance spectroscopy. Cancer Res., 46: 4087-4090, 1986.
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Yu G., Ahmad S., Aquino A., Fairchild C. R., Trepel J. B., Ohno S., Suzuki K., Tsuruo T., Cowan K. H., Glazer R. I. Transfection with protein kinase C α confers increased multidrug resistance to MCF-7 cells expressing P-glycoprotein. Cancer Commun., 3: 181-189, 1991.
    OpenUrlPubMed
  12. ↵
    Alaoui Jamali M. A., Yin M. B., Mazzoni A., Bankusli I., Rustum Y. M. Relationship between cytotoxicity, drug accumulation. DNA damage and repair of human ovarian cancer cells treated with doxorubicin: modulation by the tiapamil analog RO11–2933. Cancer Chemother Pharmacol., 25: 77-83, 1989.
    OpenUrlCrossRefPubMed
  13. ↵
    Mi Q., Cui B., Silva G. L., Lantvit D., Lim E., Chai H., You M., Hollingshead M. G., Mayo J. G., Kinghorn A. D., Pezzuto J. M. Pervilleine A, a novel tropane alkaloid that reverses the multidrug-resistance phenotype. Cancer Res., 61: 4030-4037, 2001.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Towbin H., Staehelin T., Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA, 76: 4350-4354, 1979.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Yang J. M., Sullivan G. F., Hait W. N. Regulation of the function of P-glycoprotein by epidermal growth factor through phospholipase C. Biochem. Pharmacol., 53: 1597-604, 1997.
    OpenUrlCrossRefPubMed
  16. ↵
    Elbashir S. M., Harborth J., Lendeckel W., Yalcin A., Weber K., Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature (Lond.), 411: 494-498, 2001.
    OpenUrlCrossRefPubMed
  17. ↵
    Jacque J. M., Triques K., Stevenson M. Modulation of HIV-1 replication by RNA interference. Nature (Lond.), 418: 435-438, 2002.
    OpenUrlCrossRefPubMed
  18. ↵
    Novina C. D., Murray M. F., Dykxhoorn D. M., Beresford P. J., Riess J., Lee S. K., Collman R. G., Lieberman J., Shankar P., Sharp P. A. siRNA-directed inhibition of HIV-1 infection. Nat. Med., 8: 681-686, 2002.
    OpenUrlCrossRefPubMed
  19. ↵
    Coburn G. A., Cullen B. R. Potent and specific inhibition of human immunodeficiency virus type 1 replication by RNA interference. J. Virol., 76: 9225-9231, 2002.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Lee N. S., Dohjima T., Bauer G., Li H., Li M. J., Ehsani A., Salvaterra P., Rossi J. Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat. Biotechnol., 20: 500-505, 2002.
    OpenUrlPubMed
  21. ↵
    Xu D., Ye D., Fisher M., Juliano R. L. Selective inhibition of P-glycoprotein expression in multidrug-resistant tumor cells by a designed transcriptional regulator. J. Pharmacol. Exp. Ther., 302: 963-971, 2002.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    Mechetner E. B., Roninson I. B. Efficient inhibition of P-glycoprotein-mediated multidrug resistance with a monoclonal antibody. Proc. Natl. Acad. Sci. USA, 89: 5824-5828, 1992.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    Astriab-Fisher A., Sergueev D. S., Fisher M., Shaw B. R., Juliano R. L. Antisense inhibition of P-glycoprotein expression using peptide-oligonucleotide conjugates. Biochem. Pharmacol., 60: 83-90, 2000.
    OpenUrlCrossRefPubMed
  24. ↵
    Yang J. M., Vassil A. D., Hait W. N. Activation of phospholipase C induces the expression of the multidrug resistance (MDR1) gene through the Raf-MAPK pathway. Mol. Pharmacol., 60: 674-680, 2001.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Fire A., Xu S., Montgomery M. K., Kostas S. A., Driver S. E., Mello C. C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature (Lond.), 391: 806-811, 1998.
    OpenUrlCrossRefPubMed
  26. ↵
    Muller C., Laurent G., Ling V. P-glycoprotein stability is affected by serum deprivation and high cell density in multidrug-resistant cells. J. Cell Physiol., 163: 538-544, 1995.
    OpenUrlCrossRefPubMed
  27. ↵
    Wells W. W., Rocque P. A., Xu D. P., Meyer E. B., Charamella L. J., Dimitrov N. V. Ascorbic acid and cell survival of adriamycin resistant and sensitive MCF-7 breast tumor cells. Free Radic. Biol. Med., 18: 699-708, 1995.
    OpenUrlCrossRefPubMed
  28. ↵
    Sui G., Soohoo C., Affar el B., Gay F., Shi Y., Forrester W. C. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc. Natl. Acad. Sci. USA, 99: 5515-5520, 2002.
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Paddison P. J., Caudy A. A., Hannon G. J. Stable suppression of gene expression by RNAi in mammalian cells. Proc. Natl. Acad. Sci. USA, 99: 1443-1448, 2002.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Miyagishi M., Taira K. U6 promoter-driven siRNAs with four uridine 3′ overhangs efficiently suppress targeted gene expression in mammalian cells. Nat. Biotechnol., 20: 497-500, 2002.
    OpenUrlCrossRefPubMed
  31. ↵
    Paul C. P., Good P. D., Winer I., Engelke D. R. Effective expression of small interfering RNA in human cells. Nat. Biotechnol., 20: 505-508, 2002.
    OpenUrlCrossRefPubMed
  32. ↵
    Lewis D. L., Hagstrom J. E., Loomis A. G., Wolff J. A., Herweijer H. Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nat. Genet., 32: 107-108, 2002.
    OpenUrlCrossRefPubMed
  33. ↵
    McCaffrey A. P., Meuse L., Pham T. T., Conklin D. S., Hannon G. J., Kay M. A. RNA interference in adult mice. Nature (Lond.), 418: 38-39, 2002.
    OpenUrlCrossRefPubMed
PreviousNext
Back to top
Cancer Research: 63 (7)
April 2003
Volume 63, Issue 7
  • Table of Contents
  • About the Cover

Sign up for alerts

View this article with LENS

Open full page PDF
Article Alerts
Sign In to Email Alerts with your Email Address
Email Article

Thank you for sharing this Cancer Research article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Small Interfering RNA-induced Suppression of MDR1 (P-Glycoprotein) Restores Sensitivity to Multidrug-resistant Cancer Cells
(Your Name) has forwarded a page to you from Cancer Research
(Your Name) thought you would be interested in this article in Cancer Research.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Citation Tools
Small Interfering RNA-induced Suppression of MDR1 (P-Glycoprotein) Restores Sensitivity to Multidrug-resistant Cancer Cells
Hao Wu, William N. Hait and Jin-Ming Yang
Cancer Res April 1 2003 (63) (7) 1515-1519;

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Small Interfering RNA-induced Suppression of MDR1 (P-Glycoprotein) Restores Sensitivity to Multidrug-resistant Cancer Cells
Hao Wu, William N. Hait and Jin-Ming Yang
Cancer Res April 1 2003 (63) (7) 1515-1519;
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • INTRODUCTION
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • Footnotes
    • References
  • Info & Metrics
  • PDF
Advertisement

Related Articles

Cited By...

More in this TOC Section

  • Antitumor Effect by Interleukin-11 Receptor α-Locus Chemokine/CCL27, Introduced into Tumor Cells through a Recombinant Adenovirus Vector
  • Mammary Carcinoma Suppression by Cellular Retinoic Acid Binding Protein-II
  • E1A, E1B Double-restricted Adenovirus for Oncolytic Gene Therapy of Gallbladder Cancer
Show more Experimental Therapeutics
  • Home
  • Alerts
  • Feedback
  • Privacy Policy
Facebook  Twitter  LinkedIn  YouTube  RSS

Articles

  • Online First
  • Current Issue
  • Past Issues
  • Meeting Abstracts

Info for

  • Authors
  • Subscribers
  • Advertisers
  • Librarians

About Cancer Research

  • About the Journal
  • Editorial Board
  • Permissions
  • Submit a Manuscript
AACR logo

Copyright © 2021 by the American Association for Cancer Research.

Cancer Research Online ISSN: 1538-7445
Cancer Research Print ISSN: 0008-5472
Journal of Cancer Research ISSN: 0099-7013
American Journal of Cancer ISSN: 0099-7374

Advertisement