Article Figures & Data
Figures
- Fig. 1.
Comparison of the COOH-terminal long terminal repeat superantigen sequences from human breast cancer with those from mouse mammary tumor virus (BR6 strain, GenBank accession number M15122). Red letters indicate the region in which specific deletions and insertions occurred in human isolates.
- Fig. 2.
Comparison of the COOH-terminal long terminal repeat superantigen peptides from human breast cancer with those from mouse mammary tumor virus BR6. ∗, stop codon.
- Fig. 3.
Amplification of an entire sag gene sequence in human breast cancer. A, left panel, PCR was performed using primers LTRsag-5 and LTRsag-3. The product of the reaction was run in a 1% agarose gel. Lane M, molecular weight marker; arrow, 1-kb marker; Lane 1, LTRsag. Right panel, Southern blot analysis using probe LTR5. B, sequence of the 963-bp entire LTRsag. C, sequence of the 310-amino acid peptide of the LTRSAG.
- Fig. 4.
Expression of mouse mammary tumor virus-like long-terminal repeat superantigen in E. coli. Bottom panel, SDS-PAGE. Expression was induced with isopropyl-1-thio-ββ-d-galactopyranoside, and the protein lysate was prepared as described in “Materials and Methods.” Approximately 80 μg of protein lysate were loaded per lane and resolved on 10% SDS-polyacrylamide gel. To normalize for loading, the gel was visualized by staining with Coomassie Blue. Top panel, Western blot analysis. The proteins were electrophoretically transferred from the SDS-polyacrylamide gel onto polyvinylidene difluoride membrane, and immunodetection was performed using the enhanced chemiluminescence Western blotting protocol. An anti-herpes simplex virus monoclonal antibody was used as a primary antibody. Lane 1, control supernatant; Lane 2, control pellet; Lane 3, induced supernatant; Lane 4, induced pellet.
- Fig. 5.
Transfection and expression of pLTRSAg in a human B-cell line. Ramos cells were transfected by using Lipofectamine 2000 (Invitrogen), and the fusion protein was detected by immunofluorescence assay. A, pLTRSAg-1-transfected Ramos cells observed under a fluorescence microscope. B, pLTRSAg-1-transfected Ramos cells observed under a light microscope. C, untransfected Ramos cells observed under a fluorescence microscope. D, untransfected Ramos cells observed under a light microscope.
- Fig. 6.
Expression of mouse mammary tumor virus long terminal repeat (LTR)-like superantigen (SAg) in transfected human B cells. Western blot analysis was performed as described in “Materials and Methods.” Protein lysates were prepared from 107 cells, and the fusion protein was purified by using a His bind purification kit (Novagen, Inc.). Top panel, expression of mouse mammary tumor virus LTR-like SAg was detected only from pLTRSAg-transfected human B-cell lines (pLTRSAG-1 and pLTRSAG-2). Bottom panel, expression of actin showed that a comparable amount of protein was loaded for all of the samples. Lane 1, control parental Ramos cell line; Lane 2, mock-transfected Ramos cells; Lane 3, pLTRSAG-2-transfected Ramos cells; Lane 4, pLTRSAG-1-transfected Ramos cells.
- Fig. 7.
Human T-cell proliferation induced by mouse mammary tumor virus-like long terminal repeat superantigen. Human T cells were isolated from CD3+ T-cell enrichment column. T cells (105), together with 104 irradiated (3000 rads) pLTRSAg-transfected Ramos cells (human B-cell line), were cocultured in each well of a 96-well plate for 72 h. After 60 h of culture, the cells were incubated with 1 μCi/well [3H]thymidine for 12 h (New England Nuclear). All cultures were harvested, and radioactivity was determined by liquid scintillation spectroscopy.
- Fig. 8.
Secretion of cytokines from the activated human T cells stimulated by mouse mammary tumor virus (MMTV)-like long terminal repeat (LTR) superantigen (SAg). T-cell enrichment column-isolated human CD3+ T cells were cocultured with irradiated (3000 rads) pLTRSAg-transfected human B cells at a ratio 10:1 cells/well in a 96-well plate. Supernatants were harvested after 72 h, and cytokines were measured by ELISA (R&D Systems Europe). A, interleukin-2 secretion by MMTV-like LTR SAg-stimulated human T cells. B, interleukin-10 secretion by MMTV-like LTR SAg-stimulated human T cells. C, tumor necrosis factor β secretion by MMTV-like LTR SAg-stimulated human T cells. D, IFN-γ secretion by MMTV-like LTR SAg-stimulated human T cells.
Tables
- Table 1
Primer and probe sequences and location in the MMTVa 3′ LTR
Primers Sequence (5′ to 3′) Location LTRorf-5 ATGCCGCGCCTGCAGCAGCAGAA 8698–8722 LTRorf-3 TTATTTATTATACCTTATGTCAAA 9637–9661 LTR5 GGTGGCAACCAGGGACTTAT 9308–9327 -
a MMTV, mouse mammary tumor virus; LTR, long terminal repeat.
-
Volume 64, Issue 12
