Table 2

Intronic primers for p63

List of the intronic primers used to amplify each exon. The sizes of each exon and of each amplified fragment are also shown. The sizes of exons 1 and 3′ are those from the start codons (ATG nucleotide sequence) and the exon/intron boundaries. The sizes of exons 14 and 15 are those from the intron/exon boundaries to the stop codons. For amplified fragments longer than 300 bp, each fragment was digested with the appropriate restriction enzyme to give two fragments smaller than 300 bp before the SSCP analysis. The names of the restriction enzymes used and the sizes of the digested fragments are given in parentheses.
ExonPrimerExon size (bp)PCR fragment size (bp)
Exon 1FGACCCTATTGCTTTTAGCCTC62235
BCATTCATAATACACAAGGCACTTC
Exon 2FCCTGCATGGTTTTATAGATTCACTTG129305 (EcoRI 197 + 108)
BGACCACCCACATTTACCTATTTAG
Exon 3FCCCTTTCCATGCCTAACTCACT133209
BCCAAAGACTGAAGAGAAAGCCTG
Exon 3′FGGCAAAATCCTGGAGCCAGAAG42140
BAAAGCATCTCTAAATGGAGTGC
Exon 4FGGCTTCAGCGGCTAATATTGGG255353 (AflIII 252 + 101)
BGTGAAGCCCATCCTTGGACTTG
Exon 5FTCTCCTTCCTTTCTCCACTGGC187284
BTGCCCACAGAATCTTGACCTTC
Exon 6FGCCACCAACATCCTGTTCATGC116259
BGTCTACTCAGTCCATAGAGGTGTTG
Exon 7FGAAGGAACAACGTCAGTTTAAACCC110245
BAAAGCAGCCACGATTTCACTTTGCC
Exon 8FGTGGTAGATCTTCAGGGGACTTTC137263
BCCAACATCTGGAGAAGATTCAACC
Exon 9FGTGTTCCCAGGATGAAACTTGC83153
BGAAGCAACCATGAACACCCAAGG
Exon 10FCCACACTTCTAACAGTTCTACAGC137278
BTCATCAATCACCCTATTGCTGATCC
Exon 11FCGTGCTCACCATCATTTCCATG158239
BCTAGCCTGTTCATCCTTCAGCC
Exon 12FCACTGGGATGCTGGTACATGATG145228
BGGGCACATGCTGTGGACTC
Exon 13FCTGTTTCCTCCTTCCTCTTCC94212
BCAGGGATTGAACTACAAGGC
Exon 14FCCCTGTTTTCATTCTCCATGACAC297366 (EcoRI 245 + 121)
BGGGATAGGAAGAGCTCACATGG
Exon 15FCATGAAGGTATAAGGAGTGTGTTTCTG115240
BACACACACTTAAAATATAGAGATAGGGC