Table 1

Sequences of antisense oligonucleotides and their target sites on the survivin mRNA

OligonucleotideSequenceTarget site on survivin mRNA (nucleotide no.)a
4018GGCACCCATGCCGCCGCCGC39–58
4002TGAATGTAGAGATGCGGTGG97–116
4003CCCAGCCTTCCAGCTCCTTG232–251
4004TCACCAAGGGTTAATTCTTC329–348
4006CTGTGACAGCCTCAACAACA821–840
4007GAGGGCGAATCAAATCCATC1461–1480
  • a The 1619-bp mRNA (GenBank accession number NM001168) was used.