Table 1

Primers used for amplification of bak coding region exon 2–6

PrimerSequenceProduct size (bp)
BAK/2FTGGTTATGGGATGGGTGAGG165
BAK/2RCTGCTTTTTCTCGCCCTTCC
BAK/3FTGCCTCCCTGAAGATGTCCT204
BAK/3RTGACTCCCAGCTTTGATCCT
BAK/4FGGCAGGGTATGGTATGGTTG262
BAK/4RTCCCGACTGCCTGGTTACTG
BAK/5FCCAACAGCAGGGAGGACATT247
BAK/5RCAATGCTATGGGATGCTCTG
BAK/6FGCAAGGGAACAGAGAAGGCA210
BAK/6RTGACCACCTTGTTTCTCCCG