Table 1

Summary of primer sequences,a annealing temperatures, and PCR product sizes used for MSP

GeneForward primer (5′→3′)Reverse primer (5′→3′)Annealing temperature (°C)Product size (bp)
RARβ M: TCGAGAACGCGAGCGATTCGbM: GACCAATCCAACCGAAACGA59146
U: TTGAGAATGTGAGTGATTTGAU: AACCAATCCAACCAAAACAA59146
TIMP-3 M: CGTTTCGTTATTTTTTGTTTTCGGTTTCM: CCGAAAACCCCGCCTCG59116
U: TTTTGTTTTGTTATTTTTTGTTTTTGGTTTTU: CCCCCAAAAACCCCACCTCA59122
p16 INK4a M: TTATTAGAGGGTGGGGCGGATCGCM: GACCCCGAACCGCGACCGTAA65150
U: TTATTAGAGGGTGGGGTGGATTGTU: CAACCCCAAACCACAACCATAA65151
MGMT M: TTTCGACGTTCGTAGGTTTTCGCM: GCACTCTTCCGAAAACGAAACG6681
U: TTTGTGTTTTGATGTTTGTAGGTTTTTGTU: AACTCCACACTCTTCCAAAAACAAAACA6693
DAPK M: GGATAGTCGGATCGAGTTAACGTCM: CCCTCCCAAACGCCGA6498
U: GGAGGATAGTTGGATTGAGTTAATGTTU: CAAATCCCTCCCAAACACCAA64106
ECAD M: TTAGGTTAGAGGGTTATCGCGTM: TAACTAAAAATTCACCTACCGAC57115
U: TAATTTTAGGTTAGAGGGTTATTGTU: CACAACCAATCAACAACACA5797
p14 ARF M: GTGTTAAAGGGCGGCGTAGCM: AAAACCCTCACTCGCGACGA64122
U: TTTTTGGTGTTAAAGGGTGGTGTAGTU: CACAAAAACCCTCACTCACAACAA64132
GSTP1 M: TTCGGGGTGTAGCGGTCGTCM: GCCCCAATACTAAATCACGACG5591
U: GATGTTTGGGGTGTAGTGGTTGTTU: CCACCCCAATACTAAATCACAACA5597
  • a References for primer sequences: Refs. 6 , 7 , 8 , 11 , 12 , 13, and 29.

  • b M, methylated-specific primers; U, unmethylated-specific primers.