Table 1

Primers, PCR products, and annealing conditions

GeneUpper primer (5′ to 3′)Lower primer (5′ to 3′)Product size (bp)AT (C°)a
VEGFgaagtggtgaagttcatggatgtccgatcgttctgtatcagtctttcc54058
bFGFatccaaaacaggacctgggcaactcccatcaccagcagag66451
GROαggatccaagcaaatggccaatgagtgttctaagccagaaa cact25060
Ang-1ggtcacactgggacagcacgtaaggagtaactgggc24451
Ang-2tgctaagctgctggtttattctctgcaccgagtcatcgta24854
IL-8atgacttccaagctggccgtggcttctcagccctcttcaaaaacttctc28960
Flt-1gaagcaacagtcaatggggatggtccactccttaca33250
Flt-4ccaggatgaagacatttgaggaaaatgctgacgtatgctg19253
KDRagactttgagcatggaagccattccaccaaaagatg31250
FGF-R1aaccccagccacaacccacgacacccagcccagctt68757
FGF-R2tcctatgacattaaccgtgttcacataaacggcagtgttaaa70257
FGF-R3gcctggactactccttcggtttgcccacgacctgct66157
FGF-R4ggctgatgcgtgagtgctgactaagcgccttggtcca47455
Tie-1agctgctgcgtttcgccagttcatagagctcggcacaggt33152
Tie-2/TEKagcagctccttcacttcgctacaagtcatcccgcagtagg32055
IL-8R1cagttacagctctaccctgcccgctgtctttgggccagggagtc96460
IL-8R2cgccaggcttaccatccaaacaggtaacacgatgacgtgccaag48860
MMP-2tcgcccatcatcaagttcgtgatctggttcttgtcc30153
MMP-9aaccaatctcaccgacagcaaaggcgtcgtcaatca31755
HPSEatctcaagtcaaccaggaaccaacatcaggaccata45350
S26gcctccaagatgacaaagccagagaatagcctgtct39756
GAPDHacatcaagaaggtggtgaagcaggctcttcctcttgtgctcttgctgg28256
  • a AT, annealing temperature.