Table 1

Primer sequences and annealing temperatures for PCR

GeneProductAnnealing temperature (°C)
CTNNB1
 F-CGTGGACAATGGCTACTCAA (exon 2)F/R codon 5–82 in exon 354
 R-TGCATACTGTCCATCAATA (exon 4)
 S-GGAGTTGGACATGGCCATGGAA (Sequencing primer)
CTNNG1
 F-GCCACGATGGAGGTGATGAAF/R codon 1–58 in exon 162
 R-CCTGGGTGTAAGTGGTGGTT
APC
 T7-trans: GGATCCTAATACGACTCACTATAGGGAGACCACCATGG
 F-T7-trans-GTCCAAGGGTAGCCAAGGF/R codon 1–79658
 R-CATCATGTCGATTGGTGTCA
 F1-T7-trans-ATGCATGTGGAACTTTGTGGF1/R1 codon 686–121158
 R1-GAGGATCCATTAGATGAAGGTGTGGACG
 F2-T7-trans-TTTCTCCATACAGGTCACGGF2/R2 codon 1106–168156
 R2-CTGTAGGAATGGTATCTCG
 F3-T7-trans-CAGGAAAATGACAATGGGAATGAF3/R3 codon 1537–224756
 R3-CTAGGGCTTTTGGAGGCTGGAGT
AXIN1
 F1-CTAATCCTTGTCCTCTTAATGGF1/R1 exon 160
 R1-CTGAACTCTCTGCCTTCGCTGTAC
 F2-TAACATGCCCTGCTTGCCTGF2/R2 exon 262
 R2-GTATCCGGGGCGGGACTT
 F3-TAACGGCTGCCTCTTTCTCCF3R3 exon 364
 R3-CTGAGGACCGCAAAGCCGGT
 F4-GTGCCTCACAGTCCTGTCCF4/R4 exon 462
 R4-GCAAGAAAACAGCACGACACC
 F5-TGGTGCTGCTTGTCCCCACF5/R5 exon 564
 R5-TCCTCACTGACAGGCGCAC
 F6-CTCGCAGCTCTTGCCCTTGF6/R6 exon 662
 R6-CTGGCTGCGTGCGGGGTG
 F7-TCACAACTTGTTCTCTTGTTCCF7/R7 exon 760
 R7-ACCCCACGACGCGGCCGT
 F8-CCTTTGACGCGGGTTGTTCCF8/R8 exon 862
 R8-GGGAGGACCCTCAGGACG
 F9-CCACCGCTGCATCTCTTTCCF9/R9 exon 966
 R9-GGGGCACCCCAGCCCTC
 F10-CCTCCTCACCTCCGTCCTGF10/R10 exon 1066
 R10-CGGCCAGCCCACCAGCCT
AXIN2
 S1-GCCGATTGCTGAGAGGAACTS1/AS1 codon 1–16562
 AS1-CGGTCTGCGCCTGGTCAAA
 S2-GCCACCAAGACCTACATAAGAS2/AS2 codon 159–29262
 AS2-TCACTGGATATCTCACTGTCG
 S3-GGTTCTGGCTATGTCTTTGCS3/AS3 codon 292–42760
 AS3-GTATCGTCTGCGGGTCTTC
 S4-CACCCCCTCTCCCTACTGCS4/AS4 codon 427–56460
 AS4-GCCTCTGCTGCCGCCAAAC
 S5-GGGGGCAGCGAGTATTACTS5/AS5 codon 551–68360
 AS5-GCGTGTTGGGTGGGGTCA
 F-CAAAGCACAAAAAAGGCCTACCF/R codon 645–71260
 R-GATTCCTGTCCCTCTGCTGAC
 S6-CCCTGACCCCACCCAACAS6/AS6 codon 693–84360
 AS6-CCAACAGTTCACCAAAGCCA