Table 1

Primer pairs used in RT-PCR

GeneSense (5′→3′)Antisense (5′→3′)
37-kDa LIM domain proteinATGACACACCTGGAGGCACAGAACAAAGAAGTAACCACGCTGCTTGAG
α (1,3)-fucosyltransferaseTCAAGACGATCCCACTGGTACCGGAACCTCTCGTAGTTGCTTCTG
α-1-antitrypsinGCCCAGAAGACAGATACATCCCACCATGCCTAAACGCTTCATCATAGG
Annexin A1CCTTGAGGAGGTTGTTTTAGCTCTGGCGAGTTCCAACACCTTTCATG
BikTGGGTCTGGCTTTCATCTACGACCCCGAGGGATCAACATATCACACAG
CD81AAGACCTTCCACGAGACGCTTGTGTGACATCAGCCCTGAAAAGG
CIITACTCCCGAGCAAACATGACAGAGCAAGATGTGGCTGAAAACCTCATC
CRABP2CATCAAAACCTCCACCACCGTGTTTGGGGCTAGGACTGCTGACTTG
Cytidine deaminaseCAACATAGAAAATGCCTGCTACCCGAAAAGTTGCTCGGAACAGGATAG
Defensin β2AGCTCCCAGCCATCAGCCATGAGCTCTGATGAGGGAGCCCTTTCTG
Dodesenoyl-CoA isomeraseATTCAAGAACCCCCCAGTGAACTGGAGATGAAGCTGACGAAGTTC
E-cadherinACAGGATGGCTGAAGGTGACAGAGCTTCATTCACATCCAGCACATCCAC
E48GACATCAGAGATGAGGACAGCATTGCGGCAACAAAACAGAAGGAGTG
EphA1GATGGGTGGAGTGAACAGCAACGACAATGGGGTGTGTCCATGTC
EMP1GAGAGTTTGTAAGGTCATGCTGGTGATTTTCCTGGGAATGCAGGCAC
G3PDHAATGCCTCCTGCACCACCAACTGCCATGTGGGCCATGAGGTCCACCAC
GA733-1CACCCACCACATCCTCATTGACTCTCAACTCCCCCAGTTCCTTG
Galectin 4GCCTTTGAGCTGGTCTTCATAGTCCCAAATGGGTTGTGGGTGATC
GS1CCCACCTCATCTTTGACATGGACGCTCAAGTTTCCGTCAGGAACC
Heparin cofactor 2CAATCTAGTGGAGTCCCTGAAGTTGCAAGAATGGTGCTAGTTGTGTACCC
IGFBP2aGCACATCCCCAACTGTGACAAGAAGAAGGAGCAGGTGTGGCATC
IGFBP6ACAGGATGTGAACCGCAGAGACAAGCACAGCTTTATTGACACCCC
Integrin β4ATCAACTACTCGGCGATCCACCACTTGGTCTGCTGGAGCTTGTG
Invariant chainGCAAAAGGCAGTTCCACCAAAGTACACCTTCAGGGGGTCAGCATTC
IQGAP1CTAACAGAGCTTGGAACCGTGGTGAGAAGGAAGATCAGGAGGTTGAC
Laminin γ1GACCCTTAGCTCCAGTTTTCTTCTGGCTGCAAACACAAGGCACAATTC
MesothelinTGGGCTACCTCTTCCTCAAGATGCCATGCTCACATTCTGCTGACTG
MHC class II DM αTGTTACCACTTCTGTGGCTGCTACTTCGTGAGTCACAATGCAGGAG
MHC class II DM βCGCAATGGGCTTCAGAATTGTGTCTCACTTGGAGTGGAAGTTGTAGG
MHC class II DP αAACACCCTCATCTGCCACATTGGCAATTCAGTCAGCCACTGGAGTAG
MHC class II DR αATATGGCAAAGAAGGAGACGGTCCCCTTGATGATGAAGATGGTCCC
MHC class II DR βGCCTGATCCAGAATGGAGATTGGTTTGTCGTACAGGGTGAGGTACAG
MHC class IAAGATAATGTATGGCTGCGACGTGTGCTGCACATGGCAGGTGTAC
MHC class IBGAGGTATTTCTACACCGCCATGTCGAAGGTTCTATCTCCTGCTGGTCTG
Na/K/Cl transporterTCTACCCAGCTTTCCAGATGTTTGGTGAGTTTGGAGCACCTGTCATAAC
Polymeric-immunoglobulin receptorGCTACGTCTCCAGCAAATATGCAGGGTCTTCATAAACCAGCTCGGG
Protein kinase C-like 1TCATTTTGGGAAGGTGCTCCTCTCGAAGACCTCCTCCTCATCATC
rab32AGGAGCGATTTGGCAACATGACCCAGCTAACATGACATCTGTAACCC
S100PTGAATCTAGCACCATGACGGAACAATCAGAGGTACATGAGCAGGCTC
SPRR1ATCAGCAGCAGAAGCAGCCTTGCTGCTGGAGTGACCGTTGAAGG
SPRR1BCCACCAGTTCTAAGGGACCATACAGGCACATTCTTTTTTGGGGGAGAC
SPRR2AATGTCTTATCAACAGCAGCAGTGTTACTTGCTCTTGGGTGGATAC
Sulphotransferase monoamine preferringGTGCCCTTCCTTGAGGTCAATGTGCCATCTTCTCCGCATAGTCC
Trefoil factor 1TTGGAGCAGAGAGGAGGCAATGCAGAGCAGTCAATCTGTGTTGTGAG
Trefoil factor 3ACGGTGGTCATGGCTGCCAGAGTGCCTCAGAAGGTGCATTCTGC
  • a IGFBP, insulin-like growth factor binding protein.