Table 1

Sequences of oligonucleotides used for PCR and EMSAa

OligonucleotidesSequences
For PCR
 hMSH2PS5′-−299GCTGAGTAAACACAGAAA−282-3′
 hMSH2PA5′-−17CTCCTGGTTGAAGAAAATGC−36-3′
 hMLH1PS5′-−220AGTAGCCGCTTCAGGGA−204-3′
 hMLH1PA5′-+39CTCGTCCAGCCGCCGAATAA+20-3′
For EMSA
 −80wt5′-−90GCTCGGGGGACGTGGGAGGGG−70-3′
 −80mt5′-−90GCTCGGGGGAACGTGGGAGGGG−70-3′
 −190wt5′-−191GCTGGGCCGCGTCTGCTTAT−172-3′
 −190mt5′-−191GCTGGGCCGCATCTGCTTAT−172-3′
 −225wt5′-−233GCAGGCATGCGCAGTAGCTA−214-3′
 −225mt5′-−233GCAGGCATCCGCAGTAGCTA−214-3′
  • a The mutation sites are in bold type.