Table 1

Sequences of primers and probes for HPP1 gene

Primers and probesSequences (5′→3′)
Quantitative MSP
 ForwardGTTATCGTCGTCGTTTTTGTTGTC
 ReverseGACTTCCGAAAAACACAAAATCG
 Probe6FAM-CCGAACAACGAACTACTAAACATCCCGCG-TAMRA
Quantitative RT-PCR
 ForwardTGCTTTCCCTACCTCCTTAAGTGA
 ReverseCTGTCATCATAACCAGAGCAATTCC
 Probe6FAM-TGCCAAACGCCCACCGGC-TAMRA