Table 2

Oligonucleotide primers used in this study

Primer designationaGene locusLocation in genebPrimer sequence (5′→3′)c
hpRfhpyIIIR226-243CTCATTGCTGTGAGGGAT
hpRrhpyIIIR668-651TCTTGATAGGATCTTGCG
hpMfhpyIIIM135-148TCCGCCTTATTTCC
hpMrhpyIIIM697-684CCGCAATGCCTGTG
hrgAf hrgA 252-272TCTCGTGAAAGAGAATTTCC
hrgAr hrgA 933-914TAAGTGTGGGTATATCAATC
locf HP0090 17-1AATAGCGCGTATTGCAT
locr HP0093 422-438CCCAAAAGTATAACGCT
NthrgAf hrgA 252-272ATAAGAATGCGGCCGCTCTCGTGAAAGAGAATTTCC
XhhrgAr hrgA 933-914CCGCTCGAGTAAGTGTGGGTATATATCAATC
hrgAinr hrgA 467-448CCGGAATTCTTTGATAAATATGACGGAG
hrgAinf hrgA 572-590CCGGAATTCTTTGATAAATATGACGGAG
catf cat −182 to −159CCGGAATTCCGGTATCGTATGGAGCGGACAACG
catr cat 674-651CCGGAATTCGTGCGCCCTTTAGTTCCTAAAGGG
hpyIIIRf HP0091 414-429CCGGAATTCTGATAGCAATGCGAGA
hpyIIIRr HP0091 413-398CCGGAATTCAGCCCCACTTCTATAC
  • a Last letter of primer designation indicates orientation: forward (f) or reverse (r).

  • b For hpyIIIR, hpyIIIM, HP0090, and HP0093, location refers to the position within the gene in strain 26695 (11) , from the first nucleotide of the initiation codon. For hrgA, location refers to the position within the gene in strain JP26, from the first nucleotide of the initiation codon.

  • c Added restriction sites underlined: GCGGCCGC (NotI), CTCGAG (XhoI), GAATTC (EcoRI).