Table 1

Oligonucleotide primer sequences

PrimerOligonucleotide sequence (5′-3′)GeneNucleotidesa
NUP98-1TAAACCAGCACCTGGGACTCTTGGAAC NUP98 1391–1417
NUP98-2TGGGGCCCCTGGATTTAATACTACGA NUP98 1520–1545
NUP98-3CTGGGCTGCTGGATTTGTTG NUP98 1748–1729
ADD3-1GCGGAATTTCTTCTTTTTCTTGGATG ADD3 2101–2076
ADD3-2GCCCACCAGCTCCTCCTAAC ADD3 1668–1687
  • a Nucleotide coordinates refer to GenBank accession nos. NM-016320.2 (NUP98) and NM-016824.1 (ADD3).