Table 1

List of primers, annealing temperatures, and product sizes for methylation-specific PCR and RT-PCR

GeneChromosome locationForward primer (5′–3′)Reverse primer (5′–3′)Annealing temperature (°C)Product size (bp)
Methylation-specific PCRa
N: TTAAG(C/T)TTTGTGAGAATTTTGCCTATAATTAATCCAAATAATCATTTA CC53425
RARβ 3p24 U: TTGAGAATGTGAGTGATTTGAAACCAATCCAACCAAAACAA62146
M: TCGAGAACGCGAGCGATTCGGACCAATCCAACCGAAACGA62146
N: GGATATGTTG GGATAGTTCCAAAAACCCCAAACCC52289
MGMT 10q26 U: TTTGTGTTTTGATGTTTGTAGGTTTTTGTAACTCCACACTCTTCCAAAAACAAAACA5993
M: TTTCGACGTTCGTAGGTTTTCGCGCACTCTTCCGAAAACGAAACG5981
N: GGAGAGGGGGAGAGTAGGTCTACAAACCCTCTACCCACCT60208
P16 9p21 U: TGGGGAGTAGTATGGAGTTGGTGGTCAACCCCAAACCACAACCATAA6281
M: CGGGGAGTAGTATGGAGTCGGCGGCGACCCCGAACCGCGACCGTAA6281
N: GGTATTTTTGTTTTTATTGGTTGGATAATACCAATCAAATTTCTCAACTCCT55185
hMLH1 3p22 U: TAAAAATGAATTAATAGGAAGAGTCTCTATAAATTACTAAATCTCTTCA60117
M: TAAAAACGAATTAATAGGAAGAGCCTCTATAAATTACTAAATCTCTTCG60117
RT-PCR
RARβGACTGTATGGATGTTCTGTCAGATTTGTCCTGGCAGACGAAGCA60256
MGMTAAAATGGACAAGGATTGTGAAACATCCGATGCAGTGTTACACG57568
P16CGGAAGGTCCCTCAGACATCTCATGAAGTCGACAGCTTCCG60385
hMLH1CAGCGGCCAGCTAATGCTATAATCCTCAAAGGACTGCAGTT60195
DNMT1ACCAAGCAAGAAGTGAAGCCGCTTCCTGCAGAAGAACCTG60336
DNMT3aCACACAGAAGCATATCCAGGAGTGAGTGGAAACCAAATACCC60550
DNMT3bAATGTGAATCCAGCCAGGAAAGGCACTGGATTACACTCCAGGAACCGT60191
MBD2AACCCTGCTGTTTGGCTTAACCGTACTTGCTGTACTCGCTCTTC60101
G3DPHTTGCAACTGTTTTAGGACTTTAGCATTGGGAAATGTTCAAGG60983
  • a N, nest primers; U, unmethylation-specific primers; and M, methylation-specific primers.