Table 1

α-Tubulin primers for RT-PCR and sequencing of Kα1-tubulin

PrimerSequence
Set 1Set 1
 Forward (−45 to −25) CCGTGCTCTGCTCCTGTCGCC
 Reverse (352–372) GTGTTGGACCGAATTCGCAAG
Set 2Set 2
 Forward (278–298) TCACAGGCAAGGAAGATGCTG
 Reverse (691–711) ATTAGCCAGATTGTGTCCTCC
Set 3Set 3
 Forward (600–620) TGCCTTCATGGTAGACAATGA
 Reverse (1027–1047) TTTGTGGATTGGTGCCCCACT
Set 4Set 4
 Forward (969–989) GGTTCCCAAAGATGTCAATGC
 Reverse (1364–1384)a TTCCTTTTGGCCCTGCAGCAT
 Forward2 (805–825) AGCCCTGAATGTTGACCTGAC
  • a The coding sequence for the reverse primer ends at nucleotide 1356.