Table 1

Primer sequences used for triple analysisa

Clone IDGeneStrandCOBRA primers (5′→)ChIP-PCR primers (5′→)RT PCR primers (5′→)
SC21G11 HSPA.2 ForwardTGTTGATGATGGGGTTGTAAATTTTCGATGGTGGGTCCCCGGAGGCACCGGTAAGGAAAACAAAA
ReverseACAAAATCACCATCACCAATAACGGGCAAGATTAGCGAGCAGGAGAGCCAGTTGATCACCTCCTG
CpG5B6 CYP27B1 ForwardAGGGGTTGAGATATGATGTTTAGGTCTGGCCGAACTTTTCTGCAATCTGCTTGCTTGGCCCTTCTG
ReverseACCATTTTCCCCAACACTCTATCCCTCAACTCGCCTTTTCCTTATCCCTTCTGCCACATGGTTCA
SC87F10 EIF1A ForwardTTTATTTTTATTTTTGGGTATGGGCCGTCCATTTCCCAACATTTTGATGCTAAAATCAATGAAACTG
ReverseCCATAAAACCACCCACCACATGTCGCCCCTCAGAGCAGCAGTCTTCTACCCATAAGCTCCAT
SC10H6 KIAA0560 ForwardGTATAGAGGAGGTTAAAGTTTTTGGTGGGCTGTTGTACGGGTTCCCCTGCATGAACTTCCGGCTAC
ReverseCCATAACAACACTCTTCCCTCCGGTCACGAACTCCGCATTGATGGTCACGAACTCCGCATTGAT
DL3D6 FLJ31663 ForwardTTTTATTAATGGTGGTGTAGAAGTCTTCCTCCATTCGCTGTCCCTGGCAGCCTAACCCTC
ReverseCCAACTTCCTCTTCCTCTTCTCCCTTTACACTTCCGGTTCACTCACCTTCTAGTGTCCGGTTGA
SC28C11 TAF2K ForwardGGTTGGTTTTTAGTTGGTTATATTACCCCGAACTCTGTCCGCTGAATTCACTGGAGGAGGTGCAGAAGGTGG
ReverseCTACTAACTTACCCTCCTATAATCCAGCCGGCAGGACGCTGTGAGTTCCTTGGGTCCTTTCGAATCA
SC12E1 IER-3 ForwardGTGATTTTTYGTATTTTTTAAGAAGAACTGGCGACCGAACGAGACTGCGCCCCTAACGCCGCATCCCTG
ReverseAACCTAACCCCAACTAAACTATACCTTGGGCGGGTCCTTCTAACTCTCTCTGTGCGCCTCGGTCCCG
SC13E11 TIGA1 ForwardTTTGGGTTTTTTGGGATGCAGGGCCTGGAGCATAGTAAGGCATTGTGGGACGGAAGC
ReverseTATCTAAAAAACTCCCTAACATAATCCAGTGAGGGACCGAGGGAACTCCCTGGCATAGTCGATG
SC13C2PredictedForwardGATTTTTGTAATTAGGTTTGTATGTGTGCCTGATCCACGCCGATTGGTTTTCGGGTCGTCATGGCTG
ReverseAATTTCCACTCYCCTATCATACATACGGCTGCCCGAGAAGGTAGGAGTTTCATCTGGTGGCCCTAGCG
SC10B6 MDS1 ForwardATTTTTTTGGTGTTTTTGATGACAAGCTTGTTGGCGATTCTAATCCAGACCTTGAAAGTCGCT
ReverseCCTACCATAAAAATAAAATCACCAAGTTTGGACACCTTCGCACCAAGTAATCTGGGGAACCGAT
SC69A9 UNG2 ForwardTTGTAAGTTGTTTAGTTGGTTGATTCCAGTTTCCATTGCGTTTCTTCCAGTTTCCATTGCGTTTCT
ReverseATAAATTCTAAAAACCCAACACTACAGGCACAGCGACTCGAACAGGCACAGCGACTCGAA
Control GTF2H4 ForwardTCAATCTCCAGGAGCCAATGTTTGTAGTCAGACGCGCTTCAATTAAGCGACGGCCCGAGAC
ReverseCTATCTCTTAACCCACTTCTACTACATTGGCTCCTGGAGATTGACCAGAAAGAGCATCCGCATCA
Control FLJ31996 ForwardGTATTGAGTAGTTTTATTAYGGAGTCTCAGGCCGCTCTAGTCAAATTTGCGGCTCCGTGGTG
ReverseAAAACAACTATCACTAAACCCCTGGAGCCGCAAGTAACGACAGGTTTCGGCCAGTGTTGACAT
Control β-Actin ForwardGGATTCCTATGTGGGCGACGAG
ReverseCGCAGCTCATTGTAGAAGGTGTGG
  • a R, mixture of A and G; Y, mixture of G and T.