Table 1

Primer and probe sequences and location in the MMTVa 3′ LTR

PrimersSequence (5′ to 3′)Location
LTRorf-5ATGCCGCGCCTGCAGCAGCAGAA8698–8722
LTRorf-3TTATTTATTATACCTTATGTCAAA9637–9661
LTR5GGTGGCAACCAGGGACTTAT9308–9327
  • a MMTV, mouse mammary tumor virus; LTR, long terminal repeat.