Table 1

Summary of primer sequences and PCR conditions for detection of Hsp47 methylation status and expression

PurposeForward primerReverse primerATaSize
MSP1M: GCGTTTGAAAGGACGTGCGATTCGGM: CTCGACGACCCGAACTACGAAACG58134
U: GTGTTTGAAAGGATGTGTGATTTGGU: CTCAACAACCCAAACTACAAAACAC58135
MSP2M: GGAGCGGGTTAAGAGTAGAATCGTGTM: CCACACACACGCAAACGTCTCCCG58109
U: GGGAGTGGGTTAAGAGTAGAATTGTGTU: CCACACACACACAAACATCTCCCAC58110
Bisulfite sequencingAGTGGGTTAGTTTATGTAGAGAGTTTGGCCAAAAACCTCCCTCAAAACCTCCC55190
RT-PCRCTGCAGTCCATCAACGAGTGGGCGAGATGGCAACAGCCTTCTTCTGC55406
  • a AT, annealing temperature; RT-PCR, reverse transcription-PCR.