Table 2

Primer sequences for candidate normalization genes

SymbolForward primerReverse primerAmplicon sizeIntron spanning
FLOT2 TGCCGTGGTGCAGAGAGAGGTGTCTGCCATGAACTTCACA115Yes
ATP5B TCACCCAGGCTGGTTCAGAAGTGGCCAGGGTAGGCTGAT80Yes
HSPCB AAGAGAGCAAGGCAAAGTTTGAGTGGTCACAATGCAGCAAGGT120Yes
S100A6 ACAAGCACACCCTGAGCAAGACCATCAGCCTTGCAATTTCA99Yes
TEGT TGCTGGATTTGCATTCCTTACAACGGCGCCTGGCATAGA151Yes
CFL1 GAAGGAGGATCTGGTGTTTATCTTCTGCTGGCATAAATCATTTTGCTCTT73Yes
FLJ20030 GGCTTTGGACTTGCAGAATGTTATAATGTAGTGTGTTACTAGTTGTCCTTTTCTC144Yes
TPT1 GATCGCGGACGGGTTGTTTCAGCGGAGGCATTTCC100Yes
UBB GGGCGGTTGGCTTTGTTGACCTGTTAGCGGATACCAGGAT91Yes
UBC GATTTGGGTCGCGGTTCTTTGCCTTGACATTCTCGATGGT134Yes
RPS13 CGAAAGCATCTTGAGAGGAACATCGAGCCAAACGGTGAATC87Yes
RPS23 TGGAGGTGCTTCTCATGCAAAATGGCAGAATTTGGCTGTTTG76Yes
GAPD TCTCCTCTGACTTCAACAGCGACCCCTGTTGCTGTAGCCAAATTC126Yes
ACTB GCCCTGAGGCACTCTTCCACGGATGTCCACGTCACACTTC100Yes
CLTC TCGCTACCTGGTACGTCGAAAGCCTTTACAGTTACTGACACTTCTTCAG150Yes
NACA GCAAAACAGAGTCGGAGTGAAAAGTAACTCCTGTAACCTGCCGAAGA77Yes
SUI1 CAGGGTGACCAACGCAAGACACAAGCACTTAAAACCCATGAAC96Yes
TUBA6 GCAGACCCCTTCAAGTTCTAGTCAGTAGAGCTCCCAGCAGGCATT95Yes