Table 2

PCR Primers

TargetForward (sense) primerReverse primermRNA product size (bp)Gene product size, bp (misses*)
AhR (std)cagaaaacagtaaagccaatccaatacaaagccattcagagcc323995 (7 misses)
CYP1A1 (up)gagacaacaggtaaaacagggURP780None
CYP1B1 (std-a§)gccactatcactgacatctcttgcctcttgcttcttatt6843,716 (0 misses)
CYP1B1 (std-b)gccactatcactgacatctagtgtccttgggaatgtg2893,323 (0 misses)
GST-M1 (up)catgatctgctacaatccagaaURP807None
GST-M3 (std)actttcctaatctgccctacctaacacacctgctctctcc8051866 (7 misses)
GST-P1 (up)tctccttcgctgactacaacURP282None
GST-T1 (std)tgccaagaagaacgacattccgccacactctccgtcaa147205 (6 misses)
NQO1 (qual only)tgaagaagaaaggatgggaggagggggaactggaatatcac223None
GPX (qual only)cgcttccagaccattgacURP318None
GAPDH (up)agccccagcaagagcacaaURP224None
β-actin (up-a)atgatgagccttcgtgccURP166None
β-actin (up-b)gccatcctaaaagccaccURP345None
36B4 (up)acggattacaccttcccacURP276None
  • NOTE: Primers used in the RNA-specific quantitative real-time RT-PCR reactions. Those gene transcript sequences that have homologous and confounding genomic DNA sequences generally in the form of processed pseudogenes were amplified using a tagged cDNA approach, as described in the Materials and Methods (18) . Reference housekeeper transcripts targeted were GAPDH, β-actin, and 36B4.

  • Abbreviations: AhR, aromatic hydrocarbon receptor; URP, universal reverse PCR primer; GPX, glutathione peroxidase.

  • * Nucleotide mismatches (misses) required for this primer set to yield this size product from genomic DNA.

  • The universal reverse transcription primer has the general formula 5′-XTnVVN-3′, where X is the sequence 5′-aacgagacgacgacagac-3′, n = 21; V is A,C, or G; and N can be any nucleotide A,C,G, or T. The universal reverse PCR primer used for these transcripts is 5′-aacgagacgacgacagac-3′ (ref. 18 ; patent pending).

  • One of the primers spans an exon/exon splice site and, therefore, yields no genomic DNA-derived PCR product.

  • § Std-a or std-b denotes one of two alternative primer sets used to target a given gene transcript (e.g., CYP1B1); “up” denotes the universal tag approach (18) ; “qual. only” denotes those primers used exclusively for qualitative gene expression buccal−lung correlation studies (NQO1 and GPX), in addition to the other listed primer sets used for both qualitative and quantitative studies. All numerical and statistical intersubject comparisons were made using identical primer sets applied to buccal RNA/cDNA samples from different subjects.