Table 1.

Primers used for RT-PCR analysis

OligonucleotidePrimer sequence (5′-3′) *Tm (°C)bp
Mouse β-actinF: ATGGATGACGATATCGCTGC54.0713
R: TTCTCCAGGGAGGAAGAGGAT
TAP-1 5′-endF: ATGGCTGCGCACGTCTGG63.0138
R: ACTCAGGCCCACCACCCA
TAP-1 3′-endF: TGGCTCGTTGGCACCCTCAAA64.0775
R: TCAGTCTGCAGGAGCCGCAAGA
TAP-1 3′-end (last 155 bp)F: TTATCACCCAGCAGCTCAGCCT61.0155
R: TCAGTCTGCAGGAGCCGCAA
TAP-1 promoter F: cggaattcGGCTCGGCTTTCCAATCA60.0557
R:gaggatccGAGCGTGAGCTGTCCAGAGTCT
pTAP-1-EGFPF (TAP-1 promoter): TTCTTCCTCTAAACGCCAGCA61.0190
R (EGFP): CTCGCCCTTGCTCACCAT
CMT.64 TAP-1F: CTCACTCTGGTCACCCTGATCAAC62.0225
R: TGGTCCAGACTTCAGCCACG
IRF1F: CAACTTCCAGGTGTCACCCAT54.9363
R: CACAGGGAATGGCCTGGAT
IRF2F: TGATGAAGAGAACGCAGAGGG54.0328
R: TTAACAGCTCTTGACACGGGC
S15F: TTCCGCAAGTTCACCTACC60.0357
R: CGGGCCGGCCATGCTTTACG
Prion proteinF: ATGGCGAACCTTGGCTACT58.0239
R: CCAACTACCACCATGAGGTTG
  • * F, forward primer; R, reverse primer.

  • Length of the PCR amplification product.

  • Restriction enzyme sites are underlined.