Table 1.

Oligonucleotide sequences from the mouse caveolin-1 promoter for generation of heterologous reporter constructs and electrophoretic mobility shift assay

OligonucleotideSequence (5′ → 3′)
CG
Cav-1 (−244/−222)GGCACTCCCCGCCCTCTGCTGCC
Cav-1 (−244/−222) MUTGGCACTCTTTTTTTTCTGCTGCC
T
Cav-1 (−124/−101)CAGCCACCGCCCCCCGCCAGCGC
Cav-1 (−124/−101) MUTCAGCCATTTTTTTTCGCCAGCGC
  • NOTE: GC-boxes are shown in italic; introduced mutations are shown in boldface; underlying nucleotides indicate nonconserved residues between the mouse and human caveolin-1 promoters (the residue found in the human caveolin-1 promoter is shown above the mouse sequence).