Table 1.

Primer sequences for DHPLC and sequencing

VariantForward sequence (5′ > 3′)Reverse sequence (5′ > 3′)Melt temperature (°C)
DHPLC primers
    BRCA1 544 C > A (P142H)GGGTTTCTCTTGGTTTCTTTGACAAATGGTTTTACCAAGGAAGG55
    BRCA1 4719 G > A (V1534M)GCTGCCCAGCAAGTATGATTTGTTTCCGTCAAATCGTGTG58 and 59
    BRCA1 1225 del 3 (D369del)GGACTCCCAGCACAGAAAAATCCCCATCATGTGAGTCATC57
    BRCA1 1605 C > T (R496C)TGGGAAAACCTATCGGAAGACCGTTTGGTTAGTTCCCTGA57
    BRCA1 2531 G > C (Q804H), BRCA1 2640 C > T (R841W)GGCACTCAGGAAAGTATCTCGAATGACTGGCGCTTTGAAAC58
    BRCA1 3582 G > C (D1155H)CCTGGAAGTAATTGTAAGCATCCGCTTTTGCTAAAAACAGCAGA56
    BRCA1 5215 G > A (R1699Q), BRCA1 5242 C > T (A1708V)GAGGCTCTTTAGCTTCTTAGGACCCAGCATCACCAGCTTATCT56
    BRCA1 5331 G > A (G1738R)TGACGTGTCTGCTCCACTTCCAGAGTGGTGGGGTGAGATT59
    BRCA2 353 A > G (Y42C)TCTTTAACTGTTCTGGGTCATGGTTTCCTTTGTGGAGTTT54
    BRCA2 1379 C > T (S384F)AGCAAACGCTGATGAATGTGCCATCTGGGCTCCATTTAGA57
    BRCA2 2834 C > T (S869L)GCTGTTGCCACCTGAAAAATTCAAGTCTGTTTCATGAAGTTCC54
    BRCA2 4021 T > A (C1265S)TGAAGCTCTGCAAAAAGCTGTTTCTTCAACAAAAGTGCCAGT54
    BRCA2 6173 G > C (S1982T)TCACCTTGTGATGTTAGTTTGGATGGAAACTTGCTTTCCACTTG56
    BRCA2 7049 G > T (G2274V)TGGAAGATGATGAACTGACAGATTGTTAGCATACCAAGTCTACTGAA56
    BRCA2 7181G > A (R2318Q)CCGTTACATTCACTGAAAATTGTAAAAACGAGACTTTTCTCATACTGT54
    BRCA2 8204G > C (R2659T)ATGGAAACTGGCAGCTATGGCAACTGGCTTGTGCAACATT57
    BRCA2 8216 A > T (E2663V), BRCA2 8222 A > G (D2665G), BRCA2 8237 C > T (S2670L)TCCTAGCTACAAAATTTTTAATTCTCATTTGCGCTCAATGAAATTATGT55
    BRCA2 8395 G > C (D2723H), BRCA2 8536 G > A (A2770T)TGCAAAAACACTTGTTCTCTGTGCAGTACATCTAAGAAATTGAGCATCC58
    BRCA2 8714 A > G (del exon 19)TCCTGACCCTAGACCTTTTCCGCAAGAGACCGAAACTCCAT56
    BRCA2 8795 A > C (E2856A)TGCCTGGCCTGATACAATTATGTCCCTTGTTGCTATTCTTTG57
Sequencing primers
    BRCA1 5215 G > A (R1699Q), BRCA1 5242 C > T (A1708V)GAGGCTCTTTAGCTTCTTAGGACAAACGTTAGGTGTGTAAAAATGCAA
    BRCA2 8395 G > C (D2723H), BRCA2 8536 G > A (A2770T)CATTGAGCGCAAATATATCTGAAACAGGAGAGCCCACCAGTTC