Table 1.

Primer sequences used for the construction of HLJ1 enhancer fragments of different lengths

Amplification primerSequence (5′ to 3′) *
Enhancer forward primers
    HLJP-FCCGCTCGAGATTACGATTCTTATGTGTGTG
    HLJP-F1CCGCTCGAGAATTTTGAAGAGTAGAAAATCGTA
    HLJP-F2CCGCTCGAGGGATTACCTAAAATGATATTATAGG
    HLJP-F5CCGCTCGAGCATTTGTCCTGTTTAATTAGGAAA
    HLJP-EFCGACGCGTATTACGATTCTTATGTGTGTG
    HLJP-EF1CGACGCGTAGAACAATTTCCGGTT
    HLJP-EF2CGACGCGTTTGATATTATTTCTTGGTGA
    HLJP-EF3CGACGCGTTTCTTATTTATCTCTCTAATAG
    HLJP-EF21CGACGCGTCCTCTGTAACCTACAGGTAG
    HLJP-EF22CGACGCGTATGGTGTTGTTAAAGTAGAGA
    HLJP-EF23CGACGCGTAAAATGCACAAAGATGAACAT
    HLJP-EF24CGACGCGTTGGCATATAGAGTAGGCGTT
    HLJP-EF25CGACGCGTTTACCCTTTATTATATTCTAAACA
    HLJP-EF26CGACGCGTAAGGTTTTCTAACATTTTATTTG
    HLJP-Emi-FCGACGCGTAAAATGCACAAAGATGA
    HLJP-Emi-SPF1CGACGCGTAAAAGTACTAAAGATGA
Enhancer reverse primers
    HLJPRE-R'CCCAAGCTTTTCGAATGCCTTGAAATTAAC
    HLJP-ERCCGCTCGAGCCTATAATATCATTTTAGGTA
    HLJP-ER1CCGCTCGAGCTATTAGAGAGATAAATAAGAAAAGTCA
    HLJP-ER2CCGCTCGAGTCACCAAGAAATAATATCAA
    HLJP-ER3CCGCTCGAGAACCGGAAATTGTTCT
    HLJP-Emi-RCCGCTCGAGAGCAATGATGATTCAG
    HLJP-Emi-APR1CCGCTCGAGAGCAATGATTAGTTAGC
  • * Restriction enzyme sites located within the PCR primers are underlined. XhoI site: CTCGAG; HindIII site: AAGCTT; MluI site: ACGCGT.