Table 1.

Primers and PCR conditions used in this investigation

ProceduresPrimer namePrimer sequencePCR condition
Genotyping of Lck-Akt2 miceHA tag forwardAGGCACTGCCCTCTTGAAGC94°C for 5 min; 40 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min; and 72°C for 10 min
Akt2 reverseTTTGGGGTTCTGAATGTGAG
Cloning of inversion breakpointsDss1 forwardTCAAAACTTTCGATCTGAATGGCTCC95°C for 5 min; 40 cycles of 95°C for 20 sec, 59°C for 20 sec, and 72°C for 1 min; and 72°C for 10 min
TCRb reverseCATTTGGCCTCAATGTCCAGATGAGT
Multiplex RT-PCRDlx5 forwardACAACCGCGTCCCGAGTGCC94°C for 4 min; 40 cycles of 94°C for 30 sec, 58°C for 30 sec, and 72°C for 2 min; and 72°C for 10 min
Dlx5 reverseCCCATCTAATAAAGCGTCCCGG
Dlx6 forwardCCAGGCTTTAAACCATCGCTTTC
Dlx6 reverseAATGCTGCCATGTTTGTGCAGATT
Ldb1 forwardGGAAGGCCGGTTGTACCTGGA
Ldb1 reverseCACCCCCCGAGCTCATGGTG