Table 1.

Nucleotide sequences of oligonucleotide probes used in EMSA analysis

Element (abbreviation)Sequences
Consensus HRE (HRE)F: CGCTACCGAGTACGTGACCG
R: ggcgCGGTCACGTACTCGGTAGCG
HRE1F: GCTAGGAGACGCAGAGCCAC
R: ggcgGTGGCTCTGCGTCTCCTAGC
HRE1 Mutated (HRE1 Mut)F: GCTAGGAGATCTAGAGCCAC
R: ggcgGTGGCTCTAGATCTCCTAGC
HRE2F: ACCTCTCCGCGCGTCCCAAA
R: ggcgTTTGGGACGCGCGGAGAGGT
HRE2 Mutated (HRE2 Mut)F: ACCTCTCCGCGAGTACTAAA
R: ggcgTTTAGTACTCGCGGAGAGGT
HRE3F: TGCTCTGCGCTGCAGCCTCC
R: ggcgGGAGGCTGCAGCGCAGAGCA
HRE4F: TCCCCGGGACGCGGGTCCGGGA
R: ggcTCCCGGACCCGCGTCCCGGGGA
  • NOTE: Consensus HRE and the putative C/EBPα promoter HRE nucleotides are represented in bold italic; bold nucleotides represent mutated bases; and unrelated nucleotides are shown in lowercase.